Incidental Mutation 'R8244:Ptx4'
ID640887
Institutional Source Beutler Lab
Gene Symbol Ptx4
Ensembl Gene ENSMUSG00000044172
Gene Namepentraxin 4
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.344) question?
Stock #R8244 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location25120760-25125268 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25122865 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 105 (K105E)
Ref Sequence ENSEMBL: ENSMUSP00000055984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054930]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054930
AA Change: K105E

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000055984
Gene: ENSMUSG00000044172
AA Change: K105E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Blast:HOX 32 122 3e-35 BLAST
coiled coil region 147 182 N/A INTRINSIC
Pfam:Pentaxin 271 460 7.3e-33 PFAM
Pfam:Laminin_G_3 277 440 2.4e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the pentraxin superfamily, whose members encode highly conserved multifunctional proteins. The encoded protein, like other members of this family, contains a conserved pentraxin domain at the C-terminus. The highest levels of expression of the protein were observed in bone marrow, small intestine and testes. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik T C 7: 27,571,579 I133T probably damaging Het
Ahnak C T 19: 9,015,673 P4774S probably benign Het
Alg5 A G 3: 54,738,800 I29V probably benign Het
Ankar A G 1: 72,651,024 I1216T probably benign Het
Ap5z1 A T 5: 142,473,980 T462S possibly damaging Het
Apc2 A T 10: 80,315,332 R2073S probably damaging Het
Apob A T 12: 8,010,548 E3010V probably damaging Het
Arid3c T G 4: 41,729,997 E66A possibly damaging Het
Atf7 A G 15: 102,528,866 S54P unknown Het
Cbx3 C T 6: 51,475,370 T55I probably benign Het
Clptm1 A T 7: 19,638,991 F205I possibly damaging Het
Cramp1l T A 17: 24,971,410 I1117F probably damaging Het
Dgkq A G 5: 108,648,712 *935Q probably null Het
Dock2 A T 11: 34,695,453 F511I probably damaging Het
Efr3a G A 15: 65,815,368 R15H probably damaging Het
Ehmt2 A G 17: 34,905,262 D385G probably damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Gm13103 T C 4: 143,853,284 Y480H probably damaging Het
Gm21680 T C 5: 25,968,985 E207G probably damaging Het
Igsf23 A T 7: 19,941,873 C141S possibly damaging Het
Ktn1 A T 14: 47,674,823 E349V probably null Het
Lrp1b T C 2: 41,506,782 D424G Het
Lrrc9 A G 12: 72,499,610 I1190V probably benign Het
Lztfl1 T A 9: 123,712,449 I102F probably damaging Het
Mapk11 G T 15: 89,145,804 T203K possibly damaging Het
Mgam T A 6: 40,750,586 I1315N probably damaging Het
Nf1 T C 11: 79,440,924 M695T probably benign Het
Pdcd4 A G 19: 53,907,534 T8A probably benign Het
Pxn C T 5: 115,552,243 P381L probably damaging Het
Rtn4rl1 T C 11: 75,265,450 L236P probably damaging Het
Sall3 G A 18: 80,973,754 P320S probably benign Het
Sh2b2 G T 5: 136,227,437 S247* probably null Het
Sim2 T A 16: 94,109,363 V208E probably damaging Het
Slc44a4 T C 17: 34,921,572 L247P probably damaging Het
Sox1 GGGCGGCGGCGGCGGCGG GGGCGGCGGCGGCGG 8: 12,396,468 probably benign Het
Tacc2 A G 7: 130,728,676 D1937G probably damaging Het
Tmem131 T C 1: 36,808,893 N1158S probably benign Het
Tns1 G T 1: 73,937,251 A1146E probably damaging Het
Tom1l1 T C 11: 90,657,821 E308G probably benign Het
Ttn T A 2: 76,828,707 K12262* probably null Het
Vps13b G T 15: 35,917,203 G3731V probably damaging Het
Wdr20 G A 12: 110,793,642 E321K probably benign Het
Zfp516 G T 18: 82,956,333 G219C probably damaging Het
Zfp979 A T 4: 147,613,476 C259S possibly damaging Het
Zscan20 T C 4: 128,585,966 T911A probably benign Het
Other mutations in Ptx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03027:Ptx4 APN 17 25125048 missense possibly damaging 0.81
IGL03373:Ptx4 APN 17 25120899 missense probably benign 0.02
IGL03394:Ptx4 APN 17 25124675 missense probably damaging 1.00
R0559:Ptx4 UTSW 17 25123108 nonsense probably null
R3765:Ptx4 UTSW 17 25122868 missense probably benign 0.02
R4629:Ptx4 UTSW 17 25122763 missense probably damaging 1.00
R4677:Ptx4 UTSW 17 25123126 missense probably benign 0.05
R4938:Ptx4 UTSW 17 25123165 nonsense probably null
R5170:Ptx4 UTSW 17 25123178 missense probably benign 0.01
R5517:Ptx4 UTSW 17 25124786 missense possibly damaging 0.58
R6614:Ptx4 UTSW 17 25122702 missense possibly damaging 0.70
R6993:Ptx4 UTSW 17 25124924 missense possibly damaging 0.70
R7070:Ptx4 UTSW 17 25122997 missense probably benign 0.04
R7230:Ptx4 UTSW 17 25123103 missense possibly damaging 0.95
R7501:Ptx4 UTSW 17 25125192 missense possibly damaging 0.95
R7845:Ptx4 UTSW 17 25124954 missense possibly damaging 0.95
R8069:Ptx4 UTSW 17 25122779 missense probably damaging 1.00
R8370:Ptx4 UTSW 17 25123340 missense possibly damaging 0.90
R8388:Ptx4 UTSW 17 25120923 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCCCATAAGAGCTGTGTTC -3'
(R):5'- ACTTGCTGTGTAAGGCTGGC -3'

Sequencing Primer
(F):5'- CCATAAGAGCTGTGTTCTCTTTACAG -3'
(R):5'- TAAGGCTGGCCAGTGCATC -3'
Posted On2020-07-28