Incidental Mutation 'R8240:Hibch'
ID640894
Institutional Source Beutler Lab
Gene Symbol Hibch
Ensembl Gene ENSMUSG00000041426
Gene Name3-hydroxyisobutyryl-Coenzyme A hydrolase
Synonyms2610509I15Rik, HIBYL-COA-H
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.457) question?
Stock #R8240 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location52844929-52920986 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 52901335 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000045606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044478] [ENSMUST00000159352]
Predicted Effect probably null
Transcript: ENSMUST00000044478
SMART Domains Protein: ENSMUSP00000045606
Gene: ENSMUSG00000041426

DomainStartEndE-ValueType
Pfam:ECH_1 43 282 6.6e-34 PFAM
Pfam:ECH_2 45 375 3.9e-141 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159352
SMART Domains Protein: ENSMUSP00000124976
Gene: ENSMUSG00000041426

DomainStartEndE-ValueType
Pfam:ECH 44 299 1.3e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for hydrolysis of both HIBYL-CoA and beta-hydroxypropionyl-CoA. Mutations in this gene have been associated with 3-hyroxyisobutyryl-CoA hydrolase deficiency. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610524H06Rik A T 5: 114,823,411 V12E probably benign Het
Ahnak2 A G 12: 112,774,648 F997L probably benign Het
Baiap3 A T 17: 25,245,314 probably null Het
Cct6b A G 11: 82,723,824 I446T probably damaging Het
Cfap206 A G 4: 34,728,902 M1T probably null Het
Clca4a T C 3: 144,970,727 Y64C probably damaging Het
Col24a1 A T 3: 145,507,702 Q1354L probably benign Het
Coro7 A G 16: 4,668,796 V171A probably damaging Het
Cyp3a44 G A 5: 145,788,447 L315F probably damaging Het
Fam208b T C 13: 3,574,388 D1854G probably benign Het
Frem1 T A 4: 82,956,248 D1379V probably benign Het
Gm9844 A C 7: 24,862,380 I35L probably benign Het
Gstm6 T A 3: 107,942,137 D119V probably damaging Het
Hcn1 ACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC 13: 117,975,733 probably benign Het
Il1rap G A 16: 26,701,251 E356K probably benign Het
Itm2c G T 1: 85,894,736 G25C probably benign Het
Klhl8 C T 5: 103,867,526 V511I probably damaging Het
Mcee A G 7: 64,411,917 H156R possibly damaging Het
Myh3 C A 11: 67,092,370 Q908K probably benign Het
Ncoa7 A G 10: 30,691,729 S318P probably benign Het
Nhsl1 A G 10: 18,526,739 N1208D probably benign Het
Olfr1234 C T 2: 89,362,552 M292I probably benign Het
Olfr763 T A 10: 129,011,897 I204K possibly damaging Het
P2rx7 C T 5: 122,655,033 P140S probably damaging Het
Plcd4 C G 1: 74,554,501 H262D probably benign Het
Prps1l1 T C 12: 34,985,141 V85A probably damaging Het
Prss27 G A 17: 24,044,945 V202I probably benign Het
Rtn4r A T 16: 18,151,394 M229L probably benign Het
Slc43a1 A G 2: 84,859,823 H491R possibly damaging Het
Slc44a2 A G 9: 21,342,185 D83G probably benign Het
Spag6l A G 16: 16,763,025 V486A probably damaging Het
Sspo A T 6: 48,483,502 Q3408L possibly damaging Het
Tjp3 G A 10: 81,273,807 T854I probably benign Het
Trim30a C T 7: 104,421,456 G250D probably benign Het
Ttll1 G T 15: 83,492,582 D313E probably damaging Het
Zfp160 A T 17: 21,026,088 N300I probably damaging Het
Zfp458 C T 13: 67,258,126 C83Y probably damaging Het
Zmym4 A T 4: 126,904,395 probably null Het
Other mutations in Hibch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Hibch APN 1 52885190 splice site probably benign
IGL00722:Hibch APN 1 52901320 missense probably damaging 0.96
IGL03130:Hibch APN 1 52885151 missense possibly damaging 0.88
IGL03327:Hibch APN 1 52920380 unclassified probably benign
IGL03346:Hibch APN 1 52920380 unclassified probably benign
R0033:Hibch UTSW 1 52905451 missense probably null 0.60
R0033:Hibch UTSW 1 52905451 missense probably null 0.60
R0494:Hibch UTSW 1 52902896 missense possibly damaging 0.73
R1853:Hibch UTSW 1 52901335 critical splice donor site probably null
R4838:Hibch UTSW 1 52885178 missense possibly damaging 0.55
R5239:Hibch UTSW 1 52865608 missense probably damaging 1.00
R5531:Hibch UTSW 1 52845069 utr 5 prime probably benign
R5583:Hibch UTSW 1 52901247 missense probably damaging 1.00
R5809:Hibch UTSW 1 52853700 missense probably benign 0.16
R6246:Hibch UTSW 1 52904642 missense probably damaging 0.99
R6365:Hibch UTSW 1 52868937 synonymous probably null
R7202:Hibch UTSW 1 52853715 splice site probably null
R8023:Hibch UTSW 1 52860038 missense probably benign 0.00
RF010:Hibch UTSW 1 52913732 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTGAGTAAAAGATGCTATCTCTAC -3'
(R):5'- ATGTTCTCAGCCCTGGAAAG -3'

Sequencing Primer
(F):5'- GTAAAAGATGCTATCTCTACTTCCTG -3'
(R):5'- TCAGCCCTGGAAAGGTGAG -3'
Posted On2020-07-28