Incidental Mutation 'R8240:Cfap206'
ID640902
Institutional Source Beutler Lab
Gene Symbol Cfap206
Ensembl Gene ENSMUSG00000028294
Gene Namecilia and flagella associated protein 206
Synonyms1700003M02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.367) question?
Stock #R8240 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location34688559-34730206 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 34728902 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000103771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029971] [ENSMUST00000108136] [ENSMUST00000137514] [ENSMUST00000162495]
Predicted Effect probably null
Transcript: ENSMUST00000029971
AA Change: M1T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029971
Gene: ENSMUSG00000028294
AA Change: M1T

DomainStartEndE-ValueType
Pfam:DUF3508 214 491 6.1e-108 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108136
AA Change: M1T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103771
Gene: ENSMUSG00000028294
AA Change: M1T

DomainStartEndE-ValueType
Pfam:DUF3508 213 493 3.8e-127 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000137514
AA Change: M1T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably null
Transcript: ENSMUST00000162495
AA Change: M1T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610524H06Rik A T 5: 114,823,411 V12E probably benign Het
Ahnak2 A G 12: 112,774,648 F997L probably benign Het
Baiap3 A T 17: 25,245,314 probably null Het
Cct6b A G 11: 82,723,824 I446T probably damaging Het
Clca4a T C 3: 144,970,727 Y64C probably damaging Het
Col24a1 A T 3: 145,507,702 Q1354L probably benign Het
Coro7 A G 16: 4,668,796 V171A probably damaging Het
Cyp3a44 G A 5: 145,788,447 L315F probably damaging Het
Fam208b T C 13: 3,574,388 D1854G probably benign Het
Frem1 T A 4: 82,956,248 D1379V probably benign Het
Gm9844 A C 7: 24,862,380 I35L probably benign Het
Gstm6 T A 3: 107,942,137 D119V probably damaging Het
Hcn1 ACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC 13: 117,975,733 probably benign Het
Hibch T A 1: 52,901,335 probably null Het
Il1rap G A 16: 26,701,251 E356K probably benign Het
Itm2c G T 1: 85,894,736 G25C probably benign Het
Klhl8 C T 5: 103,867,526 V511I probably damaging Het
Mcee A G 7: 64,411,917 H156R possibly damaging Het
Myh3 C A 11: 67,092,370 Q908K probably benign Het
Ncoa7 A G 10: 30,691,729 S318P probably benign Het
Nhsl1 A G 10: 18,526,739 N1208D probably benign Het
Olfr1234 C T 2: 89,362,552 M292I probably benign Het
Olfr763 T A 10: 129,011,897 I204K possibly damaging Het
P2rx7 C T 5: 122,655,033 P140S probably damaging Het
Plcd4 C G 1: 74,554,501 H262D probably benign Het
Prps1l1 T C 12: 34,985,141 V85A probably damaging Het
Prss27 G A 17: 24,044,945 V202I probably benign Het
Rtn4r A T 16: 18,151,394 M229L probably benign Het
Slc43a1 A G 2: 84,859,823 H491R possibly damaging Het
Slc44a2 A G 9: 21,342,185 D83G probably benign Het
Spag6l A G 16: 16,763,025 V486A probably damaging Het
Sspo A T 6: 48,483,502 Q3408L possibly damaging Het
Tjp3 G A 10: 81,273,807 T854I probably benign Het
Trim30a C T 7: 104,421,456 G250D probably benign Het
Ttll1 G T 15: 83,492,582 D313E probably damaging Het
Zfp160 A T 17: 21,026,088 N300I probably damaging Het
Zfp458 C T 13: 67,258,126 C83Y probably damaging Het
Zmym4 A T 4: 126,904,395 probably null Het
Other mutations in Cfap206
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00797:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL00798:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL00826:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL00919:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01062:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01064:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01069:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01070:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01086:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01087:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01090:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01098:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01111:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01133:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01135:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01147:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01152:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01153:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01154:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01155:Cfap206 APN 4 34721562 missense probably damaging 1.00
IGL01289:Cfap206 APN 4 34716469 missense probably null 0.98
IGL01845:Cfap206 APN 4 34719610 missense possibly damaging 0.57
IGL02115:Cfap206 APN 4 34722623 missense possibly damaging 0.54
IGL03241:Cfap206 APN 4 34711553 missense probably damaging 1.00
IGL03405:Cfap206 APN 4 34716445 missense possibly damaging 0.82
ANU05:Cfap206 UTSW 4 34721562 missense probably damaging 1.00
BB001:Cfap206 UTSW 4 34728833 missense probably benign 0.10
BB011:Cfap206 UTSW 4 34728833 missense probably benign 0.10
R0012:Cfap206 UTSW 4 34714519 missense possibly damaging 0.76
R0689:Cfap206 UTSW 4 34722668 missense probably benign 0.23
R0730:Cfap206 UTSW 4 34711391 missense probably benign
R1567:Cfap206 UTSW 4 34716490 missense probably benign 0.01
R1694:Cfap206 UTSW 4 34719058 missense probably damaging 1.00
R1706:Cfap206 UTSW 4 34688875 missense probably damaging 1.00
R1837:Cfap206 UTSW 4 34728813 missense probably damaging 1.00
R1909:Cfap206 UTSW 4 34722714 missense probably benign
R2098:Cfap206 UTSW 4 34719053 nonsense probably null
R2568:Cfap206 UTSW 4 34711566 nonsense probably null
R3125:Cfap206 UTSW 4 34716310 missense possibly damaging 0.48
R3784:Cfap206 UTSW 4 34716445 missense probably damaging 0.99
R5249:Cfap206 UTSW 4 34714502 missense probably benign
R5483:Cfap206 UTSW 4 34711404 missense probably benign 0.39
R5569:Cfap206 UTSW 4 34724892 missense probably damaging 1.00
R6247:Cfap206 UTSW 4 34692530 missense probably benign
R6555:Cfap206 UTSW 4 34719049 missense probably damaging 1.00
R6791:Cfap206 UTSW 4 34711414 missense possibly damaging 0.76
R6865:Cfap206 UTSW 4 34714448 missense possibly damaging 0.57
R7164:Cfap206 UTSW 4 34719656 missense probably benign
R7814:Cfap206 UTSW 4 34716347 missense probably benign 0.01
R7924:Cfap206 UTSW 4 34728833 missense probably benign 0.10
R8092:Cfap206 UTSW 4 34728897 missense possibly damaging 0.62
R8323:Cfap206 UTSW 4 34719647 missense probably benign 0.00
Z1176:Cfap206 UTSW 4 34719661 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCATCAGGAAAACGCCTAAG -3'
(R):5'- AGGGTGGCATGATTTAAATTCAGG -3'

Sequencing Primer
(F):5'- GAGTACACTGTAGCTGTCTTCAGAC -3'
(R):5'- CTCAGTAGACAGTGTGGA -3'
Posted On2020-07-28