Incidental Mutation 'R0098:Cyp20a1'
ID64091
Institutional Source Beutler Lab
Gene Symbol Cyp20a1
Ensembl Gene ENSMUSG00000049439
Gene Namecytochrome P450, family 20, subfamily a, polypeptide 1
Synonyms
MMRRC Submission 038384-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0098 (G1)
Quality Score137
Status Validated
Chromosome1
Chromosomal Location60343323-60388060 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 60387254 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 452 (E452*)
Ref Sequence ENSEMBL: ENSMUSP00000050823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060608] [ENSMUST00000148443]
Predicted Effect probably null
Transcript: ENSMUST00000060608
AA Change: E452*
SMART Domains Protein: ENSMUSP00000050823
Gene: ENSMUSG00000049439
AA Change: E452*

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:p450 40 456 1.5e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148443
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases that catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein lacks one amino acid of the conserved heme binding site. It also lacks the conserved I-helix motif AGX(D,E)T, suggesting that its substrate may carry its own oxygen. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,073,540 I97T probably damaging Het
Acpp C T 9: 104,319,945 probably null Het
Adam32 T A 8: 24,914,389 Y200F possibly damaging Het
Alpk2 A G 18: 65,349,911 L342S probably damaging Het
Arfgef3 A G 10: 18,589,642 V2151A probably damaging Het
Atm T C 9: 53,518,569 D389G probably benign Het
Atp10b A T 11: 43,189,604 S236C probably benign Het
B3gat1 C T 9: 26,756,941 R276C probably damaging Het
Cndp1 T A 18: 84,628,824 E246D probably damaging Het
Crebbp A G 16: 4,091,928 L1078P probably damaging Het
Emb T C 13: 117,267,498 V262A probably damaging Het
Ephb1 C T 9: 102,041,140 R390H probably damaging Het
Faf1 T C 4: 109,935,499 L556S probably damaging Het
Fbf1 A T 11: 116,148,119 probably null Het
Gid8 T A 2: 180,714,735 I55N possibly damaging Het
Gm8773 T A 5: 5,575,355 L17Q possibly damaging Het
Hexa T C 9: 59,558,100 Y213H probably damaging Het
Kalrn A T 16: 33,975,619 I1262K possibly damaging Het
Lrp1 C T 10: 127,552,738 V3281I probably benign Het
Lrp2 T C 2: 69,475,412 D2935G probably damaging Het
Lypd6 T A 2: 50,190,780 V160E probably benign Het
Muc19 C T 15: 91,892,907 noncoding transcript Het
Mybpc1 T C 10: 88,529,564 D899G probably benign Het
Myo18a A G 11: 77,845,765 E1564G probably damaging Het
Nrxn3 A G 12: 89,260,201 D202G probably damaging Het
Palld C A 8: 61,525,086 G890V probably damaging Het
Pcx C A 19: 4,601,747 probably benign Het
Plcg1 T C 2: 160,732,000 W62R probably damaging Het
Ppa2 C T 3: 133,370,473 probably benign Het
Ppp1r18 A G 17: 35,867,996 I254M probably benign Het
Prune2 A G 19: 17,123,903 E2257G possibly damaging Het
Rd3 A G 1: 191,985,300 M244V probably benign Het
Rfx5 T A 3: 94,958,368 V326E probably damaging Het
Rgs3 G C 4: 62,625,906 R305P probably damaging Het
Rpp40 A G 13: 35,898,987 Y173H probably benign Het
Ryr3 T C 2: 112,901,031 N645D probably damaging Het
Sema3e T C 5: 14,252,432 V657A possibly damaging Het
Serpina3n T A 12: 104,413,518 V390E probably damaging Het
Shank1 A G 7: 44,313,285 Y141C unknown Het
Stat2 T A 10: 128,283,262 H428Q probably damaging Het
Stat5a A T 11: 100,875,626 Q378L probably damaging Het
Tfrc G T 16: 32,623,426 V490F probably damaging Het
Tnnt1 T C 7: 4,509,045 N155S probably damaging Het
Topaz1 T C 9: 122,790,123 Y1262H possibly damaging Het
Ubxn8 T C 8: 33,635,365 probably benign Het
Unk A G 11: 116,050,169 Y252C probably damaging Het
Vmn2r66 A C 7: 85,005,757 M448R probably damaging Het
Zfp386 T A 12: 116,059,214 L184* probably null Het
Zfp985 T C 4: 147,577,109 S4P probably damaging Het
Other mutations in Cyp20a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02146:Cyp20a1 APN 1 60371251 missense possibly damaging 0.79
IGL02725:Cyp20a1 APN 1 60366706 missense probably benign 0.08
IGL03394:Cyp20a1 APN 1 60366681 missense probably damaging 0.99
R0003:Cyp20a1 UTSW 1 60387126 splice site probably benign
R0098:Cyp20a1 UTSW 1 60387254 nonsense probably null
R0217:Cyp20a1 UTSW 1 60343466 splice site probably benign
R0491:Cyp20a1 UTSW 1 60371327 missense possibly damaging 0.71
R1543:Cyp20a1 UTSW 1 60376194 splice site probably benign
R4519:Cyp20a1 UTSW 1 60387147 missense probably damaging 1.00
R4621:Cyp20a1 UTSW 1 60376099 missense probably benign
R4930:Cyp20a1 UTSW 1 60366719 missense probably damaging 0.98
R4980:Cyp20a1 UTSW 1 60363214 missense probably damaging 1.00
R5088:Cyp20a1 UTSW 1 60363350 missense probably damaging 0.99
R5356:Cyp20a1 UTSW 1 60379387 missense probably benign 0.08
R5545:Cyp20a1 UTSW 1 60376082 missense possibly damaging 0.71
R5897:Cyp20a1 UTSW 1 60353061 missense probably damaging 1.00
R5926:Cyp20a1 UTSW 1 60363242 missense possibly damaging 0.52
R6317:Cyp20a1 UTSW 1 60352124 missense probably damaging 1.00
R6320:Cyp20a1 UTSW 1 60352172 critical splice donor site probably null
R7471:Cyp20a1 UTSW 1 60354640 missense probably damaging 0.99
R7681:Cyp20a1 UTSW 1 60353033 missense probably benign 0.01
R7715:Cyp20a1 UTSW 1 60372605 missense probably benign 0.00
R8033:Cyp20a1 UTSW 1 60372591 missense not run
Z1177:Cyp20a1 UTSW 1 60353010 missense not run
Predicted Primers PCR Primer
(F):5'- GCACATGGGAATGTCCAGAACTGAG -3'
(R):5'- ACATCATGAAGCACTAGCAGGTTTTACA -3'

Sequencing Primer
(F):5'- GATGATCTCTTAATGACAGCCAGC -3'
(R):5'- GCACATACTCTAACTGGGCA -3'
Posted On2013-08-06