Incidental Mutation 'R8240:Zfp458'
ID640923
Institutional Source Beutler Lab
Gene Symbol Zfp458
Ensembl Gene ENSMUSG00000055480
Gene Namezinc finger protein 458
SynonymsRslcan-7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R8240 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location67254918-67278466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 67258126 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 83 (C83Y)
Ref Sequence ENSEMBL: ENSMUSP00000047222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045969]
Predicted Effect probably damaging
Transcript: ENSMUST00000045969
AA Change: C83Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047222
Gene: ENSMUSG00000055480
AA Change: C83Y

DomainStartEndE-ValueType
KRAB 5 65 5.27e-32 SMART
ZnF_C2H2 81 103 2.09e-3 SMART
ZnF_C2H2 109 131 1.03e-2 SMART
ZnF_C2H2 137 159 4.11e-2 SMART
ZnF_C2H2 193 215 2.17e1 SMART
ZnF_C2H2 221 243 2.95e-3 SMART
ZnF_C2H2 249 271 7.9e-4 SMART
ZnF_C2H2 277 299 6.32e-3 SMART
ZnF_C2H2 305 327 3.52e-1 SMART
ZnF_C2H2 333 355 1.38e-3 SMART
ZnF_C2H2 361 383 3.63e-3 SMART
ZnF_C2H2 389 411 1.2e-3 SMART
ZnF_C2H2 417 439 3.52e-1 SMART
ZnF_C2H2 445 467 4.87e-4 SMART
ZnF_C2H2 473 495 7.26e-3 SMART
ZnF_C2H2 501 523 1.18e-2 SMART
ZnF_C2H2 529 551 1.56e-2 SMART
ZnF_C2H2 557 579 2.05e-2 SMART
ZnF_C2H2 585 607 7.78e-3 SMART
ZnF_C2H2 641 663 1.76e-1 SMART
ZnF_C2H2 669 691 5.21e-4 SMART
ZnF_C2H2 697 719 5.14e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the C2H2-type zinc finger gene family. The zinc finger proteins are involved in gene regulation and development, and are quite conserved throughout evolution. Like this gene product, a third of the zinc finger proteins containing C2H2 fingers also contain the KRAB domain, which has been found to be involved in protein-protein interactions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610524H06Rik A T 5: 114,823,411 V12E probably benign Het
Ahnak2 A G 12: 112,774,648 F997L probably benign Het
Baiap3 A T 17: 25,245,314 probably null Het
Cct6b A G 11: 82,723,824 I446T probably damaging Het
Cfap206 A G 4: 34,728,902 M1T probably null Het
Clca4a T C 3: 144,970,727 Y64C probably damaging Het
Col24a1 A T 3: 145,507,702 Q1354L probably benign Het
Coro7 A G 16: 4,668,796 V171A probably damaging Het
Cyp3a44 G A 5: 145,788,447 L315F probably damaging Het
Fam208b T C 13: 3,574,388 D1854G probably benign Het
Frem1 T A 4: 82,956,248 D1379V probably benign Het
Gm9844 A C 7: 24,862,380 I35L probably benign Het
Gstm6 T A 3: 107,942,137 D119V probably damaging Het
Hcn1 ACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC 13: 117,975,733 probably benign Het
Hibch T A 1: 52,901,335 probably null Het
Il1rap G A 16: 26,701,251 E356K probably benign Het
Itm2c G T 1: 85,894,736 G25C probably benign Het
Klhl8 C T 5: 103,867,526 V511I probably damaging Het
Mcee A G 7: 64,411,917 H156R possibly damaging Het
Myh3 C A 11: 67,092,370 Q908K probably benign Het
Ncoa7 A G 10: 30,691,729 S318P probably benign Het
Nhsl1 A G 10: 18,526,739 N1208D probably benign Het
Olfr1234 C T 2: 89,362,552 M292I probably benign Het
Olfr763 T A 10: 129,011,897 I204K possibly damaging Het
P2rx7 C T 5: 122,655,033 P140S probably damaging Het
Plcd4 C G 1: 74,554,501 H262D probably benign Het
Prps1l1 T C 12: 34,985,141 V85A probably damaging Het
Prss27 G A 17: 24,044,945 V202I probably benign Het
Rtn4r A T 16: 18,151,394 M229L probably benign Het
Slc43a1 A G 2: 84,859,823 H491R possibly damaging Het
Slc44a2 A G 9: 21,342,185 D83G probably benign Het
Spag6l A G 16: 16,763,025 V486A probably damaging Het
Sspo A T 6: 48,483,502 Q3408L possibly damaging Het
Tjp3 G A 10: 81,273,807 T854I probably benign Het
Trim30a C T 7: 104,421,456 G250D probably benign Het
Ttll1 G T 15: 83,492,582 D313E probably damaging Het
Zfp160 A T 17: 21,026,088 N300I probably damaging Het
Zmym4 A T 4: 126,904,395 probably null Het
Other mutations in Zfp458
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01672:Zfp458 APN 13 67257236 missense probably benign 0.01
IGL01989:Zfp458 APN 13 67259627 missense probably damaging 0.98
IGL02168:Zfp458 APN 13 67258034 missense probably damaging 0.98
IGL02620:Zfp458 APN 13 67257994 missense probably damaging 1.00
R0014:Zfp458 UTSW 13 67258090 missense possibly damaging 0.71
R0014:Zfp458 UTSW 13 67258090 missense possibly damaging 0.71
R0025:Zfp458 UTSW 13 67257898 missense probably damaging 0.98
R0066:Zfp458 UTSW 13 67259609 nonsense probably null
R0257:Zfp458 UTSW 13 67259642 nonsense probably null
R1218:Zfp458 UTSW 13 67256209 missense probably damaging 0.99
R1292:Zfp458 UTSW 13 67256690 missense probably damaging 1.00
R1490:Zfp458 UTSW 13 67257509 missense probably damaging 1.00
R1664:Zfp458 UTSW 13 67258080 missense possibly damaging 0.95
R2169:Zfp458 UTSW 13 67257049 missense probably damaging 1.00
R3769:Zfp458 UTSW 13 67257482 missense probably damaging 1.00
R5305:Zfp458 UTSW 13 67256318 missense probably benign 0.31
R5364:Zfp458 UTSW 13 67257948 nonsense probably null
R5426:Zfp458 UTSW 13 67257192 nonsense probably null
R5760:Zfp458 UTSW 13 67257789 missense probably damaging 1.00
R6151:Zfp458 UTSW 13 67257598 missense possibly damaging 0.95
R6186:Zfp458 UTSW 13 67257637 missense probably damaging 1.00
R6298:Zfp458 UTSW 13 67256806 missense probably damaging 1.00
R7368:Zfp458 UTSW 13 67257236 missense probably benign 0.01
R7483:Zfp458 UTSW 13 67256914 missense possibly damaging 0.94
R7711:Zfp458 UTSW 13 67259600 missense possibly damaging 0.95
R7921:Zfp458 UTSW 13 67256116 makesense probably null
R7993:Zfp458 UTSW 13 67257170 missense probably damaging 1.00
R8429:Zfp458 UTSW 13 67258088 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGGAACGTGGAAGGCTTTAC -3'
(R):5'- CTATGTGGTCATAATTCAGTGGAAG -3'

Sequencing Primer
(F):5'- CGTGGAAGGCTTTACTACATATTTC -3'
(R):5'- CACCTATTCTGTGTTGTAAATTAGGC -3'
Posted On2020-07-28