Incidental Mutation 'R0098:Lrp2'
ID 64093
Institutional Source Beutler Lab
Gene Symbol Lrp2
Ensembl Gene ENSMUSG00000027070
Gene Name low density lipoprotein receptor-related protein 2
Synonyms D230004K18Rik, b2b1625.2Clo, Megalin, Gp330
MMRRC Submission 038384-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0098 (G1)
Quality Score 196
Status Validated
Chromosome 2
Chromosomal Location 69254679-69416373 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 69305756 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 2935 (D2935G)
Ref Sequence ENSEMBL: ENSMUSP00000079752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080953]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000080953
AA Change: D2935G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000079752
Gene: ENSMUSG00000027070
AA Change: D2935G

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
LDLa 27 64 5.63e-13 SMART
LDLa 66 105 2.25e-12 SMART
EGF 107 143 2.59e1 SMART
LDLa 107 144 9.29e-14 SMART
LDLa 146 181 6.18e-10 SMART
LDLa 182 219 1.08e-14 SMART
LDLa 221 258 1.05e-12 SMART
LDLa 264 302 1.66e-10 SMART
EGF 310 346 3.23e0 SMART
EGF 350 385 2.32e-1 SMART
LY 414 457 3.88e-3 SMART
LY 458 500 1.17e-6 SMART
LY 501 547 5.96e-13 SMART
LY 548 590 1.94e-12 SMART
LY 591 634 2.66e0 SMART
EGF 661 704 7.76e-3 SMART
LY 732 774 1.76e0 SMART
LY 775 817 3.64e-8 SMART
LY 818 860 1.11e-3 SMART
LY 861 903 2.11e-13 SMART
LY 905 946 9.33e-1 SMART
EGF 972 1013 1.73e0 SMART
LDLa 1024 1061 1.05e-12 SMART
LDLa 1065 1103 4.65e-14 SMART
LDLa 1109 1146 3.63e-16 SMART
LDLa 1149 1186 5.5e-16 SMART
LDLa 1187 1225 1.43e-14 SMART
LDLa 1230 1269 2.1e-12 SMART
LDLa 1271 1308 3.63e-16 SMART
LDLa 1312 1351 4.69e-10 SMART
EGF 1353 1390 9.7e-4 SMART
EGF_CA 1391 1430 6.54e-10 SMART
LY 1457 1501 1.43e-1 SMART
LY 1502 1544 2e-14 SMART
LY 1545 1590 3.03e-14 SMART
LY 1591 1633 5.48e-12 SMART
LY 1635 1677 1.18e-2 SMART
EGF 1704 1742 5.2e-4 SMART
LY 1771 1812 1.68e1 SMART
LY 1813 1856 1.91e-2 SMART
LY 1859 1911 1.88e-10 SMART
LY 1912 1954 7.69e-7 SMART
LY 1955 1994 3e1 SMART
EGF 2022 2060 1.18e-2 SMART
LY 2088 2135 1.14e1 SMART
LY 2136 2182 2.11e-4 SMART
LY 2183 2226 2.22e-12 SMART
LY 2227 2269 1.24e-10 SMART
EGF 2346 2384 2.07e1 SMART
LY 2459 2501 9.91e-10 SMART
LY 2503 2543 1.48e-8 SMART
LY 2544 2586 6.85e-13 SMART
LY 2587 2627 8.13e-1 SMART
EGF_like 2655 2694 3.5e1 SMART
LDLa 2700 2739 2.86e-14 SMART
LDLa 2741 2778 8.09e-14 SMART
LDLa 2780 2820 3.19e-12 SMART
LDLa 2822 2862 6.94e-13 SMART
LDLa 2864 2903 9.29e-14 SMART
LDLa 2907 2947 4.79e-16 SMART
LDLa 2949 2992 8.41e-12 SMART
LDLa 2994 3031 1.08e-14 SMART
LDLa 3033 3072 1.83e-12 SMART
LDLa 3076 3113 1.16e-14 SMART
EGF 3115 3153 8.57e-5 SMART
EGF_CA 3154 3194 3.56e-11 SMART
LY 3221 3263 9.77e-9 SMART
LY 3264 3306 1.22e-9 SMART
LY 3312 3358 5.44e-7 SMART
LY 3359 3401 1.83e-13 SMART
LY 3402 3443 1.41e-5 SMART
EGF 3470 3511 8.91e-3 SMART
LDLa 3513 3552 1.79e-15 SMART
LDLa 3554 3593 9.89e-9 SMART
LDLa 3595 3634 3.07e-14 SMART
LDLa 3636 3675 3.34e-15 SMART
LDLa 3679 3718 1.39e-12 SMART
LDLa 3720 3758 3.83e-15 SMART
LDLa 3760 3797 7.15e-15 SMART
LDLa 3799 3836 2.86e-14 SMART
LDLa 3843 3882 2.38e-11 SMART
LDLa 3884 3924 3.66e-12 SMART
LDLa 3929 3966 1.93e-11 SMART
EGF 3971 4008 6.3e-3 SMART
EGF_CA 4009 4050 1.36e-7 SMART
low complexity region 4072 4084 N/A INTRINSIC
LY 4136 4178 6.2e-11 SMART
LY 4179 4222 4.32e-10 SMART
LY 4223 4266 3.78e-15 SMART
LY 4267 4306 4.53e1 SMART
EGF 4335 4367 3.46e0 SMART
EGF 4368 4413 1.53e-1 SMART
transmembrane domain 4425 4447 N/A INTRINSIC
low complexity region 4454 4472 N/A INTRINSIC
low complexity region 4616 4636 N/A INTRINSIC
Meta Mutation Damage Score 0.8763 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, low density lipoprotein-related protein 2 (LRP2) or megalin, is a multi-ligand endocytic receptor that is expressed in many different tissues but primarily in absorptive epithilial tissues such as the kidney. This glycoprotein has a large amino-terminal extracellular domain, a single transmembrane domain, and a short carboxy-terminal cytoplasmic tail. The extracellular ligand-binding-domains bind diverse macromolecules including albumin, apolipoproteins B and E, and lipoprotein lipase. The LRP2 protein is critical for the reuptake of numerous ligands, including lipoproteins, sterols, vitamin-binding proteins, and hormones. This protein also has a role in cell-signaling; extracellular ligands include parathyroid horomones and the morphogen sonic hedgehog while cytosolic ligands include MAP kinase scaffold proteins and JNK interacting proteins. Recycling of this membrane receptor is regulated by phosphorylation of its cytoplasmic domain. Mutations in this gene cause Donnai-Barrow syndrome (DBS) and facio-oculoacoustico-renal syndrome (FOAR).[provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit lung and kidney epithelial defects, impaired B12 uptake, reduced proliferation of the neuroepithelium resulting in lack of olfactory bulbs, forebrain fusions, ventricular defects, and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,127,689 (GRCm39) I97T probably damaging Het
Acp3 C T 9: 104,197,144 (GRCm39) probably null Het
Adam32 T A 8: 25,404,405 (GRCm39) Y200F possibly damaging Het
Alpk2 A G 18: 65,482,982 (GRCm39) L342S probably damaging Het
Arfgef3 A G 10: 18,465,390 (GRCm39) V2151A probably damaging Het
Atm T C 9: 53,429,869 (GRCm39) D389G probably benign Het
Atp10b A T 11: 43,080,431 (GRCm39) S236C probably benign Het
B3gat1 C T 9: 26,668,237 (GRCm39) R276C probably damaging Het
Cndp1 T A 18: 84,646,949 (GRCm39) E246D probably damaging Het
Crebbp A G 16: 3,909,792 (GRCm39) L1078P probably damaging Het
Cyp20a1 G T 1: 60,426,413 (GRCm39) E452* probably null Het
Emb T C 13: 117,404,034 (GRCm39) V262A probably damaging Het
Ephb1 C T 9: 101,918,339 (GRCm39) R390H probably damaging Het
Faf1 T C 4: 109,792,696 (GRCm39) L556S probably damaging Het
Fam237b T A 5: 5,625,355 (GRCm39) L17Q possibly damaging Het
Fbf1 A T 11: 116,038,945 (GRCm39) probably null Het
Gid8 T A 2: 180,356,528 (GRCm39) I55N possibly damaging Het
Hexa T C 9: 59,465,383 (GRCm39) Y213H probably damaging Het
Kalrn A T 16: 33,795,989 (GRCm39) I1262K possibly damaging Het
Lrp1 C T 10: 127,388,607 (GRCm39) V3281I probably benign Het
Lypd6 T A 2: 50,080,792 (GRCm39) V160E probably benign Het
Muc19 C T 15: 91,777,101 (GRCm39) noncoding transcript Het
Mybpc1 T C 10: 88,365,426 (GRCm39) D899G probably benign Het
Myo18a A G 11: 77,736,591 (GRCm39) E1564G probably damaging Het
Nrxn3 A G 12: 89,226,971 (GRCm39) D202G probably damaging Het
Palld C A 8: 61,978,120 (GRCm39) G890V probably damaging Het
Pcx C A 19: 4,651,775 (GRCm39) probably benign Het
Plcg1 T C 2: 160,573,920 (GRCm39) W62R probably damaging Het
Ppa2 C T 3: 133,076,234 (GRCm39) probably benign Het
Ppp1r18 A G 17: 36,178,888 (GRCm39) I254M probably benign Het
Prune2 A G 19: 17,101,267 (GRCm39) E2257G possibly damaging Het
Rd3 A G 1: 191,717,261 (GRCm39) M244V probably benign Het
Rfx5 T A 3: 94,865,679 (GRCm39) V326E probably damaging Het
Rgs3 G C 4: 62,544,143 (GRCm39) R305P probably damaging Het
Rpp40 A G 13: 36,082,970 (GRCm39) Y173H probably benign Het
Ryr3 T C 2: 112,731,376 (GRCm39) N645D probably damaging Het
Sema3e T C 5: 14,302,446 (GRCm39) V657A possibly damaging Het
Serpina3n T A 12: 104,379,777 (GRCm39) V390E probably damaging Het
Shank1 A G 7: 43,962,709 (GRCm39) Y141C unknown Het
Stat2 T A 10: 128,119,131 (GRCm39) H428Q probably damaging Het
Stat5a A T 11: 100,766,452 (GRCm39) Q378L probably damaging Het
Tfrc G T 16: 32,442,244 (GRCm39) V490F probably damaging Het
Tnnt1 T C 7: 4,512,044 (GRCm39) N155S probably damaging Het
Topaz1 T C 9: 122,619,188 (GRCm39) Y1262H possibly damaging Het
Ubxn8 T C 8: 34,125,393 (GRCm39) probably benign Het
Unk A G 11: 115,940,995 (GRCm39) Y252C probably damaging Het
Vmn2r66 A C 7: 84,654,965 (GRCm39) M448R probably damaging Het
Zfp386 T A 12: 116,022,834 (GRCm39) L184* probably null Het
Zfp985 T C 4: 147,661,566 (GRCm39) S4P probably damaging Het
Other mutations in Lrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Lrp2 APN 2 69,338,123 (GRCm39) missense probably damaging 1.00
IGL00594:Lrp2 APN 2 69,316,624 (GRCm39) missense probably benign 0.00
IGL00782:Lrp2 APN 2 69,331,989 (GRCm39) missense probably benign 0.14
IGL00821:Lrp2 APN 2 69,289,860 (GRCm39) missense probably damaging 1.00
IGL00897:Lrp2 APN 2 69,352,225 (GRCm39) missense possibly damaging 0.86
IGL01065:Lrp2 APN 2 69,299,780 (GRCm39) missense possibly damaging 0.94
IGL01087:Lrp2 APN 2 69,354,417 (GRCm39) missense probably damaging 1.00
IGL01095:Lrp2 APN 2 69,322,776 (GRCm39) nonsense probably null
IGL01131:Lrp2 APN 2 69,329,583 (GRCm39) missense probably damaging 1.00
IGL01350:Lrp2 APN 2 69,341,328 (GRCm39) missense probably damaging 0.96
IGL01352:Lrp2 APN 2 69,333,870 (GRCm39) missense possibly damaging 0.77
IGL01358:Lrp2 APN 2 69,382,814 (GRCm39) splice site probably benign
IGL01375:Lrp2 APN 2 69,308,910 (GRCm39) splice site probably benign
IGL01384:Lrp2 APN 2 69,313,846 (GRCm39) missense probably damaging 1.00
IGL01384:Lrp2 APN 2 69,284,156 (GRCm39) missense probably null 1.00
IGL01411:Lrp2 APN 2 69,312,611 (GRCm39) missense probably damaging 1.00
IGL01418:Lrp2 APN 2 69,355,630 (GRCm39) missense probably benign
IGL01444:Lrp2 APN 2 69,274,060 (GRCm39) missense possibly damaging 0.94
IGL01464:Lrp2 APN 2 69,302,783 (GRCm39) missense probably damaging 0.98
IGL01528:Lrp2 APN 2 69,322,804 (GRCm39) missense probably damaging 1.00
IGL01663:Lrp2 APN 2 69,259,050 (GRCm39) missense probably benign
IGL01761:Lrp2 APN 2 69,311,579 (GRCm39) missense possibly damaging 0.85
IGL01780:Lrp2 APN 2 69,316,528 (GRCm39) missense possibly damaging 0.66
IGL01994:Lrp2 APN 2 69,313,945 (GRCm39) missense probably benign 0.08
IGL02015:Lrp2 APN 2 69,357,922 (GRCm39) missense probably benign 0.00
IGL02104:Lrp2 APN 2 69,340,762 (GRCm39) missense probably damaging 1.00
IGL02132:Lrp2 APN 2 69,367,960 (GRCm39) missense probably benign 0.01
IGL02134:Lrp2 APN 2 69,343,723 (GRCm39) critical splice acceptor site probably null
IGL02197:Lrp2 APN 2 69,297,224 (GRCm39) missense probably benign 0.01
IGL02212:Lrp2 APN 2 69,281,608 (GRCm39) missense probably benign 0.00
IGL02240:Lrp2 APN 2 69,365,390 (GRCm39) missense probably benign
IGL02248:Lrp2 APN 2 69,313,152 (GRCm39) missense probably damaging 1.00
IGL02369:Lrp2 APN 2 69,294,980 (GRCm39) missense probably damaging 1.00
IGL02416:Lrp2 APN 2 69,299,977 (GRCm39) missense probably damaging 1.00
IGL02417:Lrp2 APN 2 69,291,649 (GRCm39) missense probably damaging 1.00
IGL02458:Lrp2 APN 2 69,352,117 (GRCm39) missense probably damaging 0.97
IGL02479:Lrp2 APN 2 69,295,145 (GRCm39) splice site probably benign
IGL02508:Lrp2 APN 2 69,333,774 (GRCm39) missense probably benign 0.04
IGL02751:Lrp2 APN 2 69,363,806 (GRCm39) missense possibly damaging 0.56
IGL02814:Lrp2 APN 2 69,337,080 (GRCm39) missense probably damaging 1.00
IGL02867:Lrp2 APN 2 69,382,794 (GRCm39) missense possibly damaging 0.67
IGL02889:Lrp2 APN 2 69,382,794 (GRCm39) missense possibly damaging 0.67
IGL02943:Lrp2 APN 2 69,285,854 (GRCm39) missense possibly damaging 0.86
IGL02948:Lrp2 APN 2 69,318,181 (GRCm39) missense probably damaging 1.00
IGL02960:Lrp2 APN 2 69,285,797 (GRCm39) splice site probably benign
IGL02990:Lrp2 APN 2 69,271,740 (GRCm39) missense possibly damaging 0.56
IGL03027:Lrp2 APN 2 69,367,897 (GRCm39) missense probably benign 0.43
IGL03038:Lrp2 APN 2 69,305,808 (GRCm39) missense probably damaging 0.99
IGL03064:Lrp2 APN 2 69,313,477 (GRCm39) missense probably damaging 0.98
IGL03107:Lrp2 APN 2 69,285,177 (GRCm39) missense probably damaging 1.00
IGL03141:Lrp2 APN 2 69,307,370 (GRCm39) missense probably damaging 0.99
IGL03154:Lrp2 APN 2 69,379,386 (GRCm39) missense probably damaging 1.00
IGL03155:Lrp2 APN 2 69,285,796 (GRCm39) splice site probably benign
IGL03163:Lrp2 APN 2 69,331,870 (GRCm39) nonsense probably null
IGL03164:Lrp2 APN 2 69,295,043 (GRCm39) missense probably damaging 1.00
IGL03169:Lrp2 APN 2 69,353,538 (GRCm39) missense probably damaging 1.00
IGL03174:Lrp2 APN 2 69,296,609 (GRCm39) missense probably damaging 1.00
IGL03189:Lrp2 APN 2 69,268,822 (GRCm39) splice site probably benign
IGL03288:Lrp2 APN 2 69,256,383 (GRCm39) missense probably benign 0.02
IGL03350:Lrp2 APN 2 69,268,797 (GRCm39) missense probably damaging 1.00
IGL03378:Lrp2 APN 2 69,261,496 (GRCm39) missense probably damaging 1.00
casual UTSW 2 69,329,607 (GRCm39) missense probably benign
nonchalant UTSW 2 69,319,673 (GRCm39) missense probably damaging 1.00
Presto UTSW 2 69,289,875 (GRCm39) nonsense probably null
relaxed UTSW 2 69,365,349 (GRCm39) missense probably damaging 1.00
unguarded UTSW 2 69,296,102 (GRCm39) missense probably benign 0.00
Unintended UTSW 2 69,348,787 (GRCm39) missense probably damaging 1.00
BB009:Lrp2 UTSW 2 69,256,371 (GRCm39) missense probably benign 0.00
BB019:Lrp2 UTSW 2 69,256,371 (GRCm39) missense probably benign 0.00
IGL02835:Lrp2 UTSW 2 69,335,648 (GRCm39) missense probably damaging 1.00
IGL03055:Lrp2 UTSW 2 69,288,792 (GRCm39) missense probably damaging 1.00
PIT4362001:Lrp2 UTSW 2 69,367,882 (GRCm39) missense probably damaging 1.00
PIT4504001:Lrp2 UTSW 2 69,305,747 (GRCm39) missense probably damaging 1.00
R0008:Lrp2 UTSW 2 69,346,895 (GRCm39) missense probably benign 0.42
R0008:Lrp2 UTSW 2 69,346,895 (GRCm39) missense probably benign 0.42
R0044:Lrp2 UTSW 2 69,357,899 (GRCm39) missense probably benign 0.01
R0044:Lrp2 UTSW 2 69,357,899 (GRCm39) missense probably damaging 0.96
R0048:Lrp2 UTSW 2 69,295,971 (GRCm39) missense probably damaging 1.00
R0098:Lrp2 UTSW 2 69,305,756 (GRCm39) missense probably damaging 1.00
R0103:Lrp2 UTSW 2 69,307,384 (GRCm39) missense probably benign
R0167:Lrp2 UTSW 2 69,256,002 (GRCm39) missense possibly damaging 0.95
R0226:Lrp2 UTSW 2 69,367,907 (GRCm39) missense probably null 1.00
R0243:Lrp2 UTSW 2 69,258,974 (GRCm39) missense probably benign 0.00
R0308:Lrp2 UTSW 2 69,313,326 (GRCm39) splice site probably benign
R0323:Lrp2 UTSW 2 69,299,983 (GRCm39) missense probably damaging 1.00
R0372:Lrp2 UTSW 2 69,365,387 (GRCm39) missense probably benign 0.10
R0374:Lrp2 UTSW 2 69,260,651 (GRCm39) missense probably damaging 1.00
R0391:Lrp2 UTSW 2 69,290,681 (GRCm39) splice site probably benign
R0391:Lrp2 UTSW 2 69,287,202 (GRCm39) missense probably damaging 0.99
R0395:Lrp2 UTSW 2 69,263,421 (GRCm39) missense possibly damaging 0.89
R0401:Lrp2 UTSW 2 69,309,492 (GRCm39) missense probably damaging 0.98
R0471:Lrp2 UTSW 2 69,355,578 (GRCm39) missense probably damaging 0.97
R0483:Lrp2 UTSW 2 69,338,145 (GRCm39) missense probably damaging 0.99
R0502:Lrp2 UTSW 2 69,341,361 (GRCm39) missense probably damaging 1.00
R0542:Lrp2 UTSW 2 69,258,998 (GRCm39) missense probably benign 0.00
R0544:Lrp2 UTSW 2 69,322,275 (GRCm39) missense probably benign 0.18
R0548:Lrp2 UTSW 2 69,367,982 (GRCm39) splice site probably benign
R0593:Lrp2 UTSW 2 69,297,350 (GRCm39) missense probably benign
R0608:Lrp2 UTSW 2 69,316,587 (GRCm39) missense probably benign 0.02
R0633:Lrp2 UTSW 2 69,278,464 (GRCm39) missense probably damaging 1.00
R0691:Lrp2 UTSW 2 69,281,724 (GRCm39) missense probably benign 0.19
R0718:Lrp2 UTSW 2 69,341,292 (GRCm39) missense probably damaging 1.00
R0737:Lrp2 UTSW 2 69,278,513 (GRCm39) missense probably damaging 0.96
R0771:Lrp2 UTSW 2 69,338,334 (GRCm39) missense probably damaging 1.00
R0784:Lrp2 UTSW 2 69,348,709 (GRCm39) missense probably benign 0.32
R0885:Lrp2 UTSW 2 69,312,697 (GRCm39) missense possibly damaging 0.75
R0947:Lrp2 UTSW 2 69,318,182 (GRCm39) missense probably damaging 1.00
R1235:Lrp2 UTSW 2 69,354,380 (GRCm39) missense probably damaging 1.00
R1293:Lrp2 UTSW 2 69,353,646 (GRCm39) splice site probably null
R1301:Lrp2 UTSW 2 69,258,948 (GRCm39) missense probably damaging 0.98
R1387:Lrp2 UTSW 2 69,287,262 (GRCm39) missense probably damaging 1.00
R1459:Lrp2 UTSW 2 69,313,738 (GRCm39) missense probably damaging 0.99
R1459:Lrp2 UTSW 2 69,290,821 (GRCm39) missense probably damaging 1.00
R1529:Lrp2 UTSW 2 69,353,526 (GRCm39) missense probably damaging 1.00
R1543:Lrp2 UTSW 2 69,331,074 (GRCm39) missense probably damaging 1.00
R1546:Lrp2 UTSW 2 69,332,954 (GRCm39) missense probably damaging 1.00
R1550:Lrp2 UTSW 2 69,333,005 (GRCm39) missense possibly damaging 0.74
R1590:Lrp2 UTSW 2 69,297,107 (GRCm39) critical splice donor site probably null
R1689:Lrp2 UTSW 2 69,333,873 (GRCm39) missense probably benign 0.09
R1693:Lrp2 UTSW 2 69,340,762 (GRCm39) missense probably damaging 1.00
R1753:Lrp2 UTSW 2 69,326,833 (GRCm39) missense possibly damaging 0.87
R1799:Lrp2 UTSW 2 69,333,874 (GRCm39) missense probably benign 0.04
R1834:Lrp2 UTSW 2 69,297,224 (GRCm39) missense probably benign 0.01
R1921:Lrp2 UTSW 2 69,353,631 (GRCm39) missense probably damaging 1.00
R2000:Lrp2 UTSW 2 69,297,434 (GRCm39) missense probably damaging 1.00
R2077:Lrp2 UTSW 2 69,338,187 (GRCm39) missense probably damaging 1.00
R2092:Lrp2 UTSW 2 69,366,365 (GRCm39) missense probably benign 0.25
R2093:Lrp2 UTSW 2 69,366,365 (GRCm39) missense probably benign 0.25
R2108:Lrp2 UTSW 2 69,336,968 (GRCm39) missense possibly damaging 0.75
R2117:Lrp2 UTSW 2 69,313,729 (GRCm39) missense probably benign 0.05
R2122:Lrp2 UTSW 2 69,314,051 (GRCm39) missense probably damaging 1.00
R2134:Lrp2 UTSW 2 69,341,411 (GRCm39) missense probably damaging 1.00
R2207:Lrp2 UTSW 2 69,297,372 (GRCm39) missense possibly damaging 0.94
R2248:Lrp2 UTSW 2 69,341,354 (GRCm39) missense probably damaging 1.00
R2264:Lrp2 UTSW 2 69,312,710 (GRCm39) missense possibly damaging 0.88
R2316:Lrp2 UTSW 2 69,322,191 (GRCm39) missense possibly damaging 0.75
R2513:Lrp2 UTSW 2 69,336,718 (GRCm39) splice site probably null
R2984:Lrp2 UTSW 2 69,256,158 (GRCm39) splice site probably null
R3085:Lrp2 UTSW 2 69,297,479 (GRCm39) missense probably benign 0.05
R3103:Lrp2 UTSW 2 69,262,328 (GRCm39) missense probably benign 0.00
R3727:Lrp2 UTSW 2 69,340,773 (GRCm39) missense probably damaging 1.00
R3730:Lrp2 UTSW 2 69,294,923 (GRCm39) missense probably damaging 0.99
R3730:Lrp2 UTSW 2 69,365,251 (GRCm39) critical splice donor site probably null
R3731:Lrp2 UTSW 2 69,294,923 (GRCm39) missense probably damaging 0.99
R3731:Lrp2 UTSW 2 69,365,251 (GRCm39) critical splice donor site probably null
R3764:Lrp2 UTSW 2 69,326,680 (GRCm39) missense probably damaging 1.00
R3768:Lrp2 UTSW 2 69,335,449 (GRCm39) missense probably benign 0.34
R3778:Lrp2 UTSW 2 69,339,548 (GRCm39) missense probably benign 0.00
R3808:Lrp2 UTSW 2 69,331,892 (GRCm39) missense probably damaging 1.00
R3809:Lrp2 UTSW 2 69,331,892 (GRCm39) missense probably damaging 1.00
R3813:Lrp2 UTSW 2 69,294,923 (GRCm39) missense probably damaging 0.99
R3828:Lrp2 UTSW 2 69,256,356 (GRCm39) missense probably benign 0.03
R3852:Lrp2 UTSW 2 69,367,909 (GRCm39) missense probably damaging 0.96
R3877:Lrp2 UTSW 2 69,289,816 (GRCm39) critical splice donor site probably null
R3877:Lrp2 UTSW 2 69,379,391 (GRCm39) missense probably damaging 1.00
R3922:Lrp2 UTSW 2 69,336,720 (GRCm39) missense probably benign
R4081:Lrp2 UTSW 2 69,343,617 (GRCm39) missense probably damaging 0.98
R4082:Lrp2 UTSW 2 69,343,617 (GRCm39) missense probably damaging 0.98
R4118:Lrp2 UTSW 2 69,260,606 (GRCm39) critical splice donor site probably null
R4193:Lrp2 UTSW 2 69,297,487 (GRCm39) missense probably damaging 1.00
R4284:Lrp2 UTSW 2 69,310,438 (GRCm39) missense possibly damaging 0.95
R4322:Lrp2 UTSW 2 69,256,335 (GRCm39) nonsense probably null
R4352:Lrp2 UTSW 2 69,262,526 (GRCm39) critical splice donor site probably null
R4407:Lrp2 UTSW 2 69,332,861 (GRCm39) missense probably damaging 1.00
R4408:Lrp2 UTSW 2 69,297,513 (GRCm39) missense probably benign 0.09
R4416:Lrp2 UTSW 2 69,357,575 (GRCm39) missense probably benign 0.18
R4426:Lrp2 UTSW 2 69,336,692 (GRCm39) missense probably benign 0.00
R4510:Lrp2 UTSW 2 69,310,406 (GRCm39) missense possibly damaging 0.58
R4511:Lrp2 UTSW 2 69,310,406 (GRCm39) missense possibly damaging 0.58
R4553:Lrp2 UTSW 2 69,343,629 (GRCm39) missense probably benign 0.13
R4591:Lrp2 UTSW 2 69,366,419 (GRCm39) missense probably damaging 1.00
R4612:Lrp2 UTSW 2 69,288,771 (GRCm39) nonsense probably null
R4622:Lrp2 UTSW 2 69,290,693 (GRCm39) missense possibly damaging 0.87
R4632:Lrp2 UTSW 2 69,319,473 (GRCm39) splice site probably null
R4633:Lrp2 UTSW 2 69,291,761 (GRCm39) missense probably benign 0.16
R4636:Lrp2 UTSW 2 69,266,983 (GRCm39) missense possibly damaging 0.93
R4657:Lrp2 UTSW 2 69,297,337 (GRCm39) missense probably damaging 1.00
R4667:Lrp2 UTSW 2 69,319,642 (GRCm39) missense probably benign 0.02
R4712:Lrp2 UTSW 2 69,336,895 (GRCm39) missense probably damaging 1.00
R4713:Lrp2 UTSW 2 69,318,310 (GRCm39) missense probably damaging 1.00
R4720:Lrp2 UTSW 2 69,311,517 (GRCm39) missense probably damaging 0.99
R4732:Lrp2 UTSW 2 69,363,899 (GRCm39) missense probably benign
R4733:Lrp2 UTSW 2 69,363,899 (GRCm39) missense probably benign
R4777:Lrp2 UTSW 2 69,312,608 (GRCm39) missense probably damaging 1.00
R4779:Lrp2 UTSW 2 69,290,059 (GRCm39) missense possibly damaging 0.75
R4786:Lrp2 UTSW 2 69,368,300 (GRCm39) missense probably damaging 1.00
R4842:Lrp2 UTSW 2 69,299,755 (GRCm39) missense probably benign 0.06
R4845:Lrp2 UTSW 2 69,339,585 (GRCm39) missense possibly damaging 0.71
R4846:Lrp2 UTSW 2 69,309,457 (GRCm39) missense probably damaging 1.00
R4938:Lrp2 UTSW 2 69,302,712 (GRCm39) missense probably damaging 0.98
R4951:Lrp2 UTSW 2 69,366,332 (GRCm39) missense probably damaging 1.00
R4990:Lrp2 UTSW 2 69,311,732 (GRCm39) missense probably benign 0.01
R5075:Lrp2 UTSW 2 69,296,102 (GRCm39) missense probably benign 0.00
R5078:Lrp2 UTSW 2 69,331,874 (GRCm39) missense possibly damaging 0.93
R5102:Lrp2 UTSW 2 69,319,502 (GRCm39) missense probably damaging 0.98
R5124:Lrp2 UTSW 2 69,331,834 (GRCm39) missense probably damaging 0.97
R5131:Lrp2 UTSW 2 69,260,686 (GRCm39) missense possibly damaging 0.74
R5141:Lrp2 UTSW 2 69,382,693 (GRCm39) splice site probably null
R5223:Lrp2 UTSW 2 69,354,397 (GRCm39) missense probably damaging 0.99
R5236:Lrp2 UTSW 2 69,287,163 (GRCm39) splice site probably null
R5267:Lrp2 UTSW 2 69,379,322 (GRCm39) missense possibly damaging 0.83
R5290:Lrp2 UTSW 2 69,343,698 (GRCm39) missense probably damaging 1.00
R5333:Lrp2 UTSW 2 69,355,572 (GRCm39) missense probably benign 0.01
R5355:Lrp2 UTSW 2 69,285,182 (GRCm39) nonsense probably null
R5356:Lrp2 UTSW 2 69,295,052 (GRCm39) missense possibly damaging 0.74
R5369:Lrp2 UTSW 2 69,289,904 (GRCm39) missense probably benign 0.04
R5486:Lrp2 UTSW 2 69,267,809 (GRCm39) missense probably benign 0.04
R5554:Lrp2 UTSW 2 69,382,768 (GRCm39) missense possibly damaging 0.92
R5584:Lrp2 UTSW 2 69,281,632 (GRCm39) missense probably damaging 1.00
R5585:Lrp2 UTSW 2 69,294,968 (GRCm39) missense possibly damaging 0.77
R5587:Lrp2 UTSW 2 69,329,607 (GRCm39) missense probably benign
R5605:Lrp2 UTSW 2 69,353,643 (GRCm39) missense probably damaging 1.00
R5637:Lrp2 UTSW 2 69,302,762 (GRCm39) missense probably damaging 1.00
R5647:Lrp2 UTSW 2 69,350,258 (GRCm39) missense probably null 0.80
R5686:Lrp2 UTSW 2 69,341,405 (GRCm39) missense possibly damaging 0.88
R5691:Lrp2 UTSW 2 69,332,897 (GRCm39) missense probably damaging 1.00
R5724:Lrp2 UTSW 2 69,281,726 (GRCm39) missense probably damaging 0.99
R5726:Lrp2 UTSW 2 69,339,491 (GRCm39) missense probably damaging 1.00
R5743:Lrp2 UTSW 2 69,297,221 (GRCm39) missense probably damaging 1.00
R5777:Lrp2 UTSW 2 69,285,869 (GRCm39) missense probably damaging 1.00
R5841:Lrp2 UTSW 2 69,310,497 (GRCm39) missense probably benign 0.00
R5892:Lrp2 UTSW 2 69,273,120 (GRCm39) missense probably benign
R5951:Lrp2 UTSW 2 69,326,667 (GRCm39) splice site probably null
R5974:Lrp2 UTSW 2 69,289,892 (GRCm39) missense probably damaging 1.00
R5980:Lrp2 UTSW 2 69,365,349 (GRCm39) missense probably damaging 1.00
R6046:Lrp2 UTSW 2 69,337,098 (GRCm39) missense probably damaging 1.00
R6113:Lrp2 UTSW 2 69,313,901 (GRCm39) missense possibly damaging 0.76
R6146:Lrp2 UTSW 2 69,341,345 (GRCm39) missense probably benign 0.00
R6177:Lrp2 UTSW 2 69,340,763 (GRCm39) frame shift probably null
R6180:Lrp2 UTSW 2 69,333,868 (GRCm39) missense possibly damaging 0.85
R6219:Lrp2 UTSW 2 69,299,822 (GRCm39) missense probably damaging 1.00
R6228:Lrp2 UTSW 2 69,312,710 (GRCm39) missense possibly damaging 0.88
R6265:Lrp2 UTSW 2 69,296,684 (GRCm39) missense probably damaging 1.00
R6312:Lrp2 UTSW 2 69,267,025 (GRCm39) missense probably damaging 1.00
R6337:Lrp2 UTSW 2 69,268,811 (GRCm39) missense probably damaging 1.00
R6376:Lrp2 UTSW 2 69,313,787 (GRCm39) missense probably benign 0.02
R6385:Lrp2 UTSW 2 69,326,128 (GRCm39) missense probably benign 0.22
R6429:Lrp2 UTSW 2 69,291,631 (GRCm39) missense probably damaging 1.00
R6458:Lrp2 UTSW 2 69,335,500 (GRCm39) missense probably benign 0.00
R6524:Lrp2 UTSW 2 69,266,983 (GRCm39) missense possibly damaging 0.93
R6555:Lrp2 UTSW 2 69,339,647 (GRCm39) missense probably benign 0.00
R6594:Lrp2 UTSW 2 69,270,267 (GRCm39) missense possibly damaging 0.58
R6599:Lrp2 UTSW 2 69,299,749 (GRCm39) missense probably damaging 1.00
R6655:Lrp2 UTSW 2 69,284,202 (GRCm39) missense probably benign 0.01
R6718:Lrp2 UTSW 2 69,314,124 (GRCm39) missense probably benign 0.09
R6736:Lrp2 UTSW 2 69,278,555 (GRCm39) missense probably benign 0.02
R6738:Lrp2 UTSW 2 69,288,832 (GRCm39) missense probably damaging 0.97
R6799:Lrp2 UTSW 2 69,314,248 (GRCm39) missense probably damaging 1.00
R6846:Lrp2 UTSW 2 69,348,787 (GRCm39) missense probably damaging 1.00
R6856:Lrp2 UTSW 2 69,343,612 (GRCm39) missense probably damaging 1.00
R6861:Lrp2 UTSW 2 69,343,721 (GRCm39) missense possibly damaging 0.77
R6888:Lrp2 UTSW 2 69,354,485 (GRCm39) missense probably damaging 0.98
R6897:Lrp2 UTSW 2 69,340,846 (GRCm39) missense probably benign
R6902:Lrp2 UTSW 2 69,289,847 (GRCm39) missense probably damaging 1.00
R6908:Lrp2 UTSW 2 69,302,709 (GRCm39) missense probably damaging 1.00
R6918:Lrp2 UTSW 2 69,319,649 (GRCm39) missense probably damaging 1.00
R6989:Lrp2 UTSW 2 69,302,799 (GRCm39) missense probably damaging 1.00
R7022:Lrp2 UTSW 2 69,313,552 (GRCm39) missense probably damaging 1.00
R7025:Lrp2 UTSW 2 69,313,372 (GRCm39) missense possibly damaging 0.90
R7026:Lrp2 UTSW 2 69,352,131 (GRCm39) missense probably damaging 0.97
R7138:Lrp2 UTSW 2 69,296,089 (GRCm39) missense possibly damaging 0.94
R7145:Lrp2 UTSW 2 69,285,152 (GRCm39) critical splice donor site probably null
R7150:Lrp2 UTSW 2 69,318,395 (GRCm39) missense probably damaging 0.99
R7165:Lrp2 UTSW 2 69,336,917 (GRCm39) missense probably damaging 0.99
R7174:Lrp2 UTSW 2 69,263,416 (GRCm39) missense probably benign 0.11
R7204:Lrp2 UTSW 2 69,302,877 (GRCm39) missense probably benign 0.25
R7275:Lrp2 UTSW 2 69,289,875 (GRCm39) nonsense probably null
R7278:Lrp2 UTSW 2 69,316,696 (GRCm39) missense probably damaging 1.00
R7296:Lrp2 UTSW 2 69,312,725 (GRCm39) missense probably benign 0.04
R7315:Lrp2 UTSW 2 69,322,166 (GRCm39) missense probably damaging 0.98
R7342:Lrp2 UTSW 2 69,309,634 (GRCm39) missense possibly damaging 0.95
R7351:Lrp2 UTSW 2 69,278,486 (GRCm39) missense probably damaging 1.00
R7352:Lrp2 UTSW 2 69,302,741 (GRCm39) missense probably benign 0.04
R7366:Lrp2 UTSW 2 69,314,150 (GRCm39) missense probably damaging 1.00
R7373:Lrp2 UTSW 2 69,331,036 (GRCm39) missense probably damaging 1.00
R7446:Lrp2 UTSW 2 69,290,018 (GRCm39) missense probably damaging 0.99
R7446:Lrp2 UTSW 2 69,262,557 (GRCm39) missense probably damaging 1.00
R7451:Lrp2 UTSW 2 69,343,677 (GRCm39) missense probably damaging 1.00
R7492:Lrp2 UTSW 2 69,367,925 (GRCm39) missense probably damaging 0.99
R7571:Lrp2 UTSW 2 69,346,747 (GRCm39) missense probably damaging 1.00
R7638:Lrp2 UTSW 2 69,307,352 (GRCm39) critical splice donor site probably null
R7664:Lrp2 UTSW 2 69,337,076 (GRCm39) missense probably damaging 1.00
R7686:Lrp2 UTSW 2 69,319,581 (GRCm39) missense probably damaging 1.00
R7711:Lrp2 UTSW 2 69,309,687 (GRCm39) critical splice acceptor site probably null
R7737:Lrp2 UTSW 2 69,326,782 (GRCm39) missense possibly damaging 0.77
R7763:Lrp2 UTSW 2 69,333,732 (GRCm39) missense probably damaging 0.99
R7775:Lrp2 UTSW 2 69,331,883 (GRCm39) missense possibly damaging 0.74
R7824:Lrp2 UTSW 2 69,331,883 (GRCm39) missense possibly damaging 0.74
R7840:Lrp2 UTSW 2 69,295,128 (GRCm39) missense probably damaging 0.98
R7878:Lrp2 UTSW 2 69,338,153 (GRCm39) missense probably damaging 1.00
R7878:Lrp2 UTSW 2 69,338,154 (GRCm39) missense probably damaging 1.00
R7895:Lrp2 UTSW 2 69,288,823 (GRCm39) missense probably damaging 0.97
R7898:Lrp2 UTSW 2 69,271,710 (GRCm39) missense probably benign 0.00
R7912:Lrp2 UTSW 2 69,259,016 (GRCm39) missense probably benign 0.03
R7923:Lrp2 UTSW 2 69,268,732 (GRCm39) missense possibly damaging 0.75
R7932:Lrp2 UTSW 2 69,256,371 (GRCm39) missense probably benign 0.00
R7940:Lrp2 UTSW 2 69,262,541 (GRCm39) missense possibly damaging 0.91
R7954:Lrp2 UTSW 2 69,333,867 (GRCm39) missense possibly damaging 0.61
R8007:Lrp2 UTSW 2 69,336,849 (GRCm39) missense probably benign 0.02
R8084:Lrp2 UTSW 2 69,339,713 (GRCm39) missense probably damaging 0.97
R8087:Lrp2 UTSW 2 69,278,473 (GRCm39) missense probably damaging 1.00
R8090:Lrp2 UTSW 2 69,295,089 (GRCm39) missense possibly damaging 0.94
R8110:Lrp2 UTSW 2 69,336,797 (GRCm39) missense probably benign
R8129:Lrp2 UTSW 2 69,260,624 (GRCm39) missense possibly damaging 0.75
R8155:Lrp2 UTSW 2 69,313,342 (GRCm39) missense possibly damaging 0.74
R8182:Lrp2 UTSW 2 69,319,673 (GRCm39) missense probably damaging 1.00
R8239:Lrp2 UTSW 2 69,311,611 (GRCm39) nonsense probably null
R8247:Lrp2 UTSW 2 69,261,431 (GRCm39) missense possibly damaging 0.76
R8327:Lrp2 UTSW 2 69,322,268 (GRCm39) missense probably damaging 1.00
R8355:Lrp2 UTSW 2 69,346,828 (GRCm39) missense probably damaging 0.99
R8404:Lrp2 UTSW 2 69,344,585 (GRCm39) nonsense probably null
R8427:Lrp2 UTSW 2 69,281,641 (GRCm39) missense probably damaging 0.97
R8463:Lrp2 UTSW 2 69,322,250 (GRCm39) missense probably damaging 1.00
R8502:Lrp2 UTSW 2 69,344,585 (GRCm39) nonsense probably null
R8529:Lrp2 UTSW 2 69,330,986 (GRCm39) missense probably damaging 0.96
R8673:Lrp2 UTSW 2 69,302,804 (GRCm39) missense probably damaging 1.00
R8698:Lrp2 UTSW 2 69,288,767 (GRCm39) missense probably benign 0.37
R8698:Lrp2 UTSW 2 69,278,583 (GRCm39) missense probably benign 0.39
R8708:Lrp2 UTSW 2 69,289,957 (GRCm39) missense probably damaging 1.00
R8716:Lrp2 UTSW 2 69,274,138 (GRCm39) missense probably benign 0.04
R8723:Lrp2 UTSW 2 69,316,648 (GRCm39) missense probably damaging 1.00
R8787:Lrp2 UTSW 2 69,382,745 (GRCm39) missense probably damaging 1.00
R8903:Lrp2 UTSW 2 69,379,382 (GRCm39) missense possibly damaging 0.68
R8944:Lrp2 UTSW 2 69,341,348 (GRCm39) missense probably damaging 1.00
R9069:Lrp2 UTSW 2 69,331,996 (GRCm39) missense probably damaging 1.00
R9076:Lrp2 UTSW 2 69,350,260 (GRCm39) missense probably benign 0.01
R9155:Lrp2 UTSW 2 69,291,713 (GRCm39) nonsense probably null
R9173:Lrp2 UTSW 2 69,299,731 (GRCm39) missense probably damaging 1.00
R9254:Lrp2 UTSW 2 69,333,891 (GRCm39) missense probably benign 0.09
R9256:Lrp2 UTSW 2 69,341,303 (GRCm39) missense probably benign 0.03
R9291:Lrp2 UTSW 2 69,310,379 (GRCm39) missense probably damaging 1.00
R9335:Lrp2 UTSW 2 69,258,983 (GRCm39) missense probably benign 0.01
R9357:Lrp2 UTSW 2 69,336,917 (GRCm39) missense probably damaging 0.99
R9368:Lrp2 UTSW 2 69,357,979 (GRCm39) missense probably damaging 0.99
R9453:Lrp2 UTSW 2 69,288,832 (GRCm39) missense probably damaging 1.00
R9546:Lrp2 UTSW 2 69,287,165 (GRCm39) critical splice donor site probably null
R9554:Lrp2 UTSW 2 69,261,497 (GRCm39) missense probably damaging 1.00
R9597:Lrp2 UTSW 2 69,260,703 (GRCm39) missense probably benign 0.02
R9601:Lrp2 UTSW 2 69,289,928 (GRCm39) missense probably damaging 1.00
R9623:Lrp2 UTSW 2 69,307,423 (GRCm39) missense probably benign 0.09
RF016:Lrp2 UTSW 2 69,339,549 (GRCm39) missense probably benign
X0011:Lrp2 UTSW 2 69,350,342 (GRCm39) missense probably damaging 1.00
X0023:Lrp2 UTSW 2 69,266,944 (GRCm39) missense probably damaging 0.99
Z1176:Lrp2 UTSW 2 69,338,225 (GRCm39) missense possibly damaging 0.88
Z1176:Lrp2 UTSW 2 69,310,386 (GRCm39) missense possibly damaging 0.66
Z1177:Lrp2 UTSW 2 69,326,812 (GRCm39) missense probably damaging 1.00
Z1177:Lrp2 UTSW 2 69,302,797 (GRCm39) missense probably benign 0.03
Z1177:Lrp2 UTSW 2 69,281,624 (GRCm39) missense probably damaging 1.00
Z1177:Lrp2 UTSW 2 69,339,633 (GRCm39) missense probably benign 0.00
Z1177:Lrp2 UTSW 2 69,331,985 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAAGCAATGGTGTCCAACAGCAG -3'
(R):5'- AAGGTTCTGACAGCCGTAAGGTTTC -3'

Sequencing Primer
(F):5'- CAGCAGGAAATAATGGTAGCATTC -3'
(R):5'- GACAGCCGTAAGGTTTCATGTATTC -3'
Posted On 2013-08-06