Incidental Mutation 'R8229:Magi3'
ID640939
Institutional Source Beutler Lab
Gene Symbol Magi3
Ensembl Gene ENSMUSG00000052539
Gene Namemembrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms4732496O19Rik, 6530407C02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.361) question?
Stock #R8229 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location104013259-104220374 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104015702 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1233 (E1233G)
Ref Sequence ENSEMBL: ENSMUSP00000112934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064371] [ENSMUST00000121198] [ENSMUST00000122303] [ENSMUST00000145727]
Predicted Effect probably benign
Transcript: ENSMUST00000064371
SMART Domains Protein: ENSMUSP00000067932
Gene: ENSMUSG00000052539

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121198
AA Change: E1233G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000112934
Gene: ENSMUSG00000052539
AA Change: E1233G

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122303
SMART Domains Protein: ENSMUSP00000113713
Gene: ENSMUSG00000052539

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145727
SMART Domains Protein: ENSMUSP00000114722
Gene: ENSMUSG00000058388

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 158 1.6e-88 PFAM
low complexity region 170 181 N/A INTRINSIC
low complexity region 347 370 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 512 534 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
transmembrane domain 647 664 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 A T 8: 24,711,738 M203K probably damaging Het
Arhgap23 G A 11: 97,453,906 V565I probably benign Het
D6Wsu163e G T 6: 126,967,003 R454L probably benign Het
Def6 A G 17: 28,217,755 D131G probably damaging Het
Erc1 T C 6: 119,753,288 T616A probably benign Het
Ermard T A 17: 15,059,334 probably benign Het
Fsip2 T C 2: 82,978,143 L1602P possibly damaging Het
Gli1 C T 10: 127,332,448 R512Q possibly damaging Het
Gm6034 A G 17: 36,056,376 T38A unknown Het
H2-M10.1 T C 17: 36,324,039 I325V probably benign Het
Inf2 A G 12: 112,611,596 D1107G unknown Het
Iws1 A G 18: 32,084,687 N448S probably benign Het
Klhl24 T C 16: 20,114,571 Y311H possibly damaging Het
Lama3 C T 18: 12,407,551 A304V probably benign Het
Limch1 A G 5: 67,028,795 E646G probably damaging Het
Lrrc8c T A 5: 105,606,536 V59E probably benign Het
Lrrn4 G A 2: 132,869,887 T672I probably damaging Het
Mgat5b A T 11: 116,947,387 K284M probably benign Het
Nedd4 G T 9: 72,731,388 K485N probably benign Het
Olfr1141 A T 2: 87,753,064 C310S probably benign Het
Olfr1219 T A 2: 89,075,038 N18Y possibly damaging Het
Olfr1453 A G 19: 13,028,197 I44T possibly damaging Het
Olfr480 C T 7: 108,066,587 M70I probably benign Het
Otud4 A G 8: 79,673,975 H1106R unknown Het
Pcdha7 C A 18: 36,974,723 S267* probably null Het
Pcdhb11 A G 18: 37,422,618 I334V probably benign Het
Phf11b A T 14: 59,331,281 L61Q probably damaging Het
Prepl T C 17: 85,081,261 D138G probably benign Het
Sipa1l1 T C 12: 82,437,848 V1592A probably damaging Het
Smc6 T A 12: 11,291,672 S564T probably benign Het
Spty2d1 A G 7: 46,997,774 V469A probably benign Het
Trim11 G A 11: 58,981,341 probably benign Het
Ttll7 T A 3: 146,901,449 I158K probably damaging Het
Ugt3a2 A G 15: 9,367,377 E402G probably damaging Het
Usp33 T C 3: 152,370,292 V383A probably benign Het
Ythdc1 A G 5: 86,809,308 probably benign Het
Ywhab T G 2: 164,014,095 Y130* probably null Het
Zfp609 T C 9: 65,703,500 K727R possibly damaging Het
Zscan30 A C 18: 23,971,680 L37R noncoding transcript Het
Other mutations in Magi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Magi3 APN 3 104014978 missense probably damaging 1.00
IGL00933:Magi3 APN 3 104015847 missense probably benign
IGL01151:Magi3 APN 3 104051374 missense probably damaging 1.00
IGL01674:Magi3 APN 3 104105721 splice site probably benign
IGL01790:Magi3 APN 3 104085244 missense probably damaging 1.00
IGL01903:Magi3 APN 3 104051210 missense possibly damaging 0.87
IGL01939:Magi3 APN 3 104054462 missense probably damaging 0.99
IGL02142:Magi3 APN 3 104015903 missense probably benign 0.32
IGL02183:Magi3 APN 3 104085347 missense probably benign 0.01
IGL02887:Magi3 APN 3 104095157 missense probably damaging 1.00
IGL03071:Magi3 APN 3 104015886 missense possibly damaging 0.51
IGL03085:Magi3 APN 3 104015339 missense possibly damaging 0.88
IGL03192:Magi3 APN 3 104043246 missense probably damaging 1.00
IGL03204:Magi3 APN 3 104105835 missense probably damaging 1.00
IGL03227:Magi3 APN 3 104051119 missense probably benign
IGL03388:Magi3 APN 3 104015841 missense probably benign 0.30
PIT4280001:Magi3 UTSW 3 104054352 missense probably damaging 1.00
PIT4504001:Magi3 UTSW 3 104015526 missense probably benign 0.05
R0092:Magi3 UTSW 3 104050964 nonsense probably null
R0514:Magi3 UTSW 3 104015022 missense probably damaging 1.00
R0569:Magi3 UTSW 3 104016042 missense probably benign 0.43
R0608:Magi3 UTSW 3 104017557 missense probably damaging 1.00
R0920:Magi3 UTSW 3 104034191 splice site probably null
R1173:Magi3 UTSW 3 104061630 critical splice donor site probably null
R1256:Magi3 UTSW 3 104027810 missense probably benign 0.08
R1391:Magi3 UTSW 3 104015058 nonsense probably null
R1559:Magi3 UTSW 3 104046853 splice site probably benign
R1568:Magi3 UTSW 3 104089527 missense probably benign 0.02
R1631:Magi3 UTSW 3 104051177 missense probably benign 0.05
R1747:Magi3 UTSW 3 104034173 missense possibly damaging 0.82
R1930:Magi3 UTSW 3 104089604 missense probably damaging 1.00
R1964:Magi3 UTSW 3 104020402 missense probably damaging 0.99
R2151:Magi3 UTSW 3 104046882 missense probably damaging 1.00
R2151:Magi3 UTSW 3 104085238 missense probably damaging 1.00
R2266:Magi3 UTSW 3 104021066 intron probably benign
R2267:Magi3 UTSW 3 104021066 intron probably benign
R2268:Magi3 UTSW 3 104021066 intron probably benign
R2519:Magi3 UTSW 3 104015765 missense probably benign 0.00
R3104:Magi3 UTSW 3 104051320 missense probably damaging 0.99
R3105:Magi3 UTSW 3 104051320 missense probably damaging 0.99
R3619:Magi3 UTSW 3 104054405 missense probably damaging 1.00
R4158:Magi3 UTSW 3 104050961 missense probably damaging 1.00
R4160:Magi3 UTSW 3 104050961 missense probably damaging 1.00
R4284:Magi3 UTSW 3 104015868 nonsense probably null
R4285:Magi3 UTSW 3 104015868 nonsense probably null
R4397:Magi3 UTSW 3 104219714 missense probably damaging 1.00
R4512:Magi3 UTSW 3 104089555 missense probably damaging 0.99
R4676:Magi3 UTSW 3 104015825 missense probably benign
R4758:Magi3 UTSW 3 104015321 missense probably benign 0.01
R4940:Magi3 UTSW 3 104051392 missense probably damaging 1.00
R5039:Magi3 UTSW 3 104105791 missense probably damaging 1.00
R5160:Magi3 UTSW 3 104027908 missense possibly damaging 0.46
R5422:Magi3 UTSW 3 104051368 missense probably damaging 1.00
R5509:Magi3 UTSW 3 104015502 missense probably benign 0.00
R5839:Magi3 UTSW 3 104219731 missense probably damaging 1.00
R5924:Magi3 UTSW 3 104054538 splice site probably null
R6018:Magi3 UTSW 3 104105812 missense probably damaging 1.00
R6189:Magi3 UTSW 3 104050865 missense probably damaging 1.00
R6235:Magi3 UTSW 3 104016068 missense probably damaging 0.99
R6244:Magi3 UTSW 3 104015697 missense probably benign 0.16
R6258:Magi3 UTSW 3 104089596 missense probably damaging 1.00
R6358:Magi3 UTSW 3 104050952 missense probably damaging 1.00
R6534:Magi3 UTSW 3 104085220 missense possibly damaging 0.75
R6806:Magi3 UTSW 3 104046969 missense possibly damaging 0.94
R6816:Magi3 UTSW 3 104089911 splice site probably null
R6897:Magi3 UTSW 3 104089557 missense probably damaging 1.00
R7011:Magi3 UTSW 3 104105754 missense probably damaging 1.00
R7039:Magi3 UTSW 3 104051383 missense probably damaging 1.00
R7196:Magi3 UTSW 3 104049168 missense probably benign 0.01
R7237:Magi3 UTSW 3 104027911 missense probably damaging 1.00
R7285:Magi3 UTSW 3 104034114 missense probably benign 0.00
R7709:Magi3 UTSW 3 104034038 missense probably damaging 1.00
R7724:Magi3 UTSW 3 104015927 missense probably benign 0.04
R7797:Magi3 UTSW 3 104051302 missense probably damaging 1.00
R7950:Magi3 UTSW 3 104016689 missense probably damaging 1.00
R8140:Magi3 UTSW 3 104034086 missense probably damaging 1.00
R8204:Magi3 UTSW 3 104051186 missense probably benign
R8229:Magi3 UTSW 3 104015701 missense possibly damaging 0.79
R8260:Magi3 UTSW 3 104015309 missense probably benign 0.01
R8348:Magi3 UTSW 3 104051215 missense probably damaging 1.00
R8368:Magi3 UTSW 3 104095063 critical splice donor site probably null
R8543:Magi3 UTSW 3 104219668 missense probably damaging 0.98
X0026:Magi3 UTSW 3 104020420 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTCCCAGCCTCTGATAATTTG -3'
(R):5'- ATGGAAGCCAGCCTGAGATG -3'

Sequencing Primer
(F):5'- GCCTTCAGTGTTTGACAGGC -3'
(R):5'- CCTGAGATGAAGTATCAGTCTGTCC -3'
Posted On2020-07-28