Incidental Mutation 'R8229:Mgat5b'
ID640954
Institutional Source Beutler Lab
Gene Symbol Mgat5b
Ensembl Gene ENSMUSG00000043857
Gene Namemannoside acetylglucosaminyltransferase 5, isoenzyme B
SynonymsGnT-IX
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R8229 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location116918863-116986948 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116947387 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 284 (K284M)
Ref Sequence ENSEMBL: ENSMUSP00000099316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103027]
Predicted Effect probably benign
Transcript: ENSMUST00000103027
AA Change: K284M

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099316
Gene: ENSMUSG00000043857
AA Change: K284M

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Glyco_transf_18 184 777 3.5e-269 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The MGAT5B gene encodes a beta-1,6-N-acetylglucosaminyltransferase (EC 2.4.1.155) that functions in the synthesis of complex cell surface N-glycans (Kaneko et al., 2003 [PubMed 14623122]).[supplied by OMIM, Nov 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit low levels of O-man-linked beta1,6-branched glycans. Mice homozygous for a different knock-out allele exhibit decreased susceptibility to cuprizone induced injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 A T 8: 24,711,738 M203K probably damaging Het
Arhgap23 G A 11: 97,453,906 V565I probably benign Het
D6Wsu163e G T 6: 126,967,003 R454L probably benign Het
Def6 A G 17: 28,217,755 D131G probably damaging Het
Erc1 T C 6: 119,753,288 T616A probably benign Het
Ermard T A 17: 15,059,334 probably benign Het
Fsip2 T C 2: 82,978,143 L1602P possibly damaging Het
Gli1 C T 10: 127,332,448 R512Q possibly damaging Het
Gm6034 A G 17: 36,056,376 T38A unknown Het
H2-M10.1 T C 17: 36,324,039 I325V probably benign Het
Inf2 A G 12: 112,611,596 D1107G unknown Het
Iws1 A G 18: 32,084,687 N448S probably benign Het
Klhl24 T C 16: 20,114,571 Y311H possibly damaging Het
Lama3 C T 18: 12,407,551 A304V probably benign Het
Limch1 A G 5: 67,028,795 E646G probably damaging Het
Lrrc8c T A 5: 105,606,536 V59E probably benign Het
Lrrn4 G A 2: 132,869,887 T672I probably damaging Het
Magi3 C A 3: 104,015,701 E1233D possibly damaging Het
Magi3 T C 3: 104,015,702 E1233G probably benign Het
Nedd4 G T 9: 72,731,388 K485N probably benign Het
Olfr1141 A T 2: 87,753,064 C310S probably benign Het
Olfr1219 T A 2: 89,075,038 N18Y possibly damaging Het
Olfr1453 A G 19: 13,028,197 I44T possibly damaging Het
Olfr480 C T 7: 108,066,587 M70I probably benign Het
Otud4 A G 8: 79,673,975 H1106R unknown Het
Pcdha7 C A 18: 36,974,723 S267* probably null Het
Pcdhb11 A G 18: 37,422,618 I334V probably benign Het
Phf11b A T 14: 59,331,281 L61Q probably damaging Het
Prepl T C 17: 85,081,261 D138G probably benign Het
Sipa1l1 T C 12: 82,437,848 V1592A probably damaging Het
Smc6 T A 12: 11,291,672 S564T probably benign Het
Spty2d1 A G 7: 46,997,774 V469A probably benign Het
Trim11 G A 11: 58,981,341 probably benign Het
Ttll7 T A 3: 146,901,449 I158K probably damaging Het
Ugt3a2 A G 15: 9,367,377 E402G probably damaging Het
Usp33 T C 3: 152,370,292 V383A probably benign Het
Ythdc1 A G 5: 86,809,308 probably benign Het
Ywhab T G 2: 164,014,095 Y130* probably null Het
Zfp609 T C 9: 65,703,500 K727R possibly damaging Het
Zscan30 A C 18: 23,971,680 L37R noncoding transcript Het
Other mutations in Mgat5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Mgat5b APN 11 116931662 missense probably damaging 0.99
IGL01315:Mgat5b APN 11 116923389 missense probably damaging 1.00
IGL01432:Mgat5b APN 11 116973376 missense probably benign
IGL01480:Mgat5b APN 11 116978452 missense probably benign 0.00
IGL02573:Mgat5b APN 11 116977714 missense probably benign 0.01
IGL02627:Mgat5b APN 11 116983616 missense probably damaging 1.00
IGL03053:Mgat5b APN 11 116923450 missense possibly damaging 0.94
R0149:Mgat5b UTSW 11 116985139 splice site probably benign
R1175:Mgat5b UTSW 11 116977796 missense probably damaging 1.00
R1242:Mgat5b UTSW 11 116978404 missense probably benign 0.08
R1341:Mgat5b UTSW 11 116978397 missense probably benign 0.38
R1666:Mgat5b UTSW 11 116983648 missense probably benign 0.01
R1667:Mgat5b UTSW 11 116947377 missense probably benign 0.00
R1668:Mgat5b UTSW 11 116983648 missense probably benign 0.01
R1702:Mgat5b UTSW 11 116948659 missense possibly damaging 0.73
R1828:Mgat5b UTSW 11 116977788 missense probably damaging 1.00
R2019:Mgat5b UTSW 11 116947348 missense probably benign 0.07
R2102:Mgat5b UTSW 11 116919429 start gained probably benign
R2382:Mgat5b UTSW 11 116919496 missense probably damaging 0.99
R4995:Mgat5b UTSW 11 116974199 critical splice donor site probably null
R5028:Mgat5b UTSW 11 116985029 missense probably damaging 1.00
R5174:Mgat5b UTSW 11 116977715 missense probably benign 0.01
R5403:Mgat5b UTSW 11 116948657 missense probably benign 0.35
R5643:Mgat5b UTSW 11 116973400 missense probably damaging 0.99
R5644:Mgat5b UTSW 11 116973400 missense probably damaging 0.99
R7116:Mgat5b UTSW 11 116944959 missense possibly damaging 0.93
R7238:Mgat5b UTSW 11 116984983 missense probably benign 0.09
R7284:Mgat5b UTSW 11 116944920 missense probably damaging 0.96
R7440:Mgat5b UTSW 11 116968445 nonsense probably null
R7721:Mgat5b UTSW 11 116966801 missense
R8179:Mgat5b UTSW 11 116931728 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATTCAGGGCTGATTGGGTCC -3'
(R):5'- TGGAGACCCAATCCTACCTG -3'

Sequencing Primer
(F):5'- ACCTTACAGTAGGTGGCAGCTTC -3'
(R):5'- TCCTACCTGGAGGCCCACTC -3'
Posted On2020-07-28