Incidental Mutation 'R8305:Fam117b'
ID 640973
Institutional Source Beutler Lab
Gene Symbol Fam117b
Ensembl Gene ENSMUSG00000041040
Gene Name family with sequence similarity 117, member B
Synonyms 2810425F24Rik, Als2cr13, 6330416D14Rik
MMRRC Submission 067716-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R8305 (G1)
Quality Score 217.009
Status Not validated
Chromosome 1
Chromosomal Location 59952165-60024505 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59952782 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 154 (T154A)
Ref Sequence ENSEMBL: ENSMUSP00000041671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036540]
AlphaFold Q3U3E2
Predicted Effect probably benign
Transcript: ENSMUST00000036540
AA Change: T154A

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000041671
Gene: ENSMUSG00000041040
AA Change: T154A

DomainStartEndE-ValueType
low complexity region 9 29 N/A INTRINSIC
low complexity region 50 104 N/A INTRINSIC
low complexity region 114 144 N/A INTRINSIC
Pfam:FAM117 211 524 2.9e-125 PFAM
low complexity region 531 542 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 64,208,844 (GRCm39) E243K possibly damaging Het
Accsl A T 2: 93,696,423 (GRCm39) H58Q probably benign Het
Actl7a T A 4: 56,743,744 (GRCm39) F90L probably benign Het
Adam5 G A 8: 25,300,719 (GRCm39) A270V possibly damaging Het
Angptl3 A G 4: 98,919,548 (GRCm39) T103A probably damaging Het
Ankhd1 T C 18: 36,780,219 (GRCm39) L1757P possibly damaging Het
Apoa4 T A 9: 46,152,453 (GRCm39) M1K probably null Het
Arih1 T A 9: 59,303,770 (GRCm39) Q445L probably benign Het
Asb14 A T 14: 26,634,054 (GRCm39) I420L probably benign Het
Bbs2 A C 8: 94,800,953 (GRCm39) V626G probably damaging Het
Cep290 C A 10: 100,380,796 (GRCm39) A1678D probably benign Het
Cilp G A 9: 65,186,286 (GRCm39) G794S probably damaging Het
Clca3a1 C T 3: 144,464,927 (GRCm39) probably benign Het
Clca3b T A 3: 144,531,698 (GRCm39) N702I probably damaging Het
Col24a1 T C 3: 145,179,937 (GRCm39) V1143A probably benign Het
Cux1 T C 5: 136,388,863 (GRCm39) T223A probably benign Het
Defa30 A T 8: 21,625,475 (GRCm39) T80S probably benign Het
Dennd1a G A 2: 37,748,093 (GRCm39) L375F probably damaging Het
Dnajc6 C T 4: 101,480,984 (GRCm39) T675I probably damaging Het
Emc9 A G 14: 55,822,556 (GRCm39) V4A probably damaging Het
Enpp3 C G 10: 24,700,827 (GRCm39) probably null Het
Filip1 G T 9: 79,727,757 (GRCm39) Y287* probably null Het
Flt3 T C 5: 147,284,864 (GRCm39) D751G probably damaging Het
Frem1 T A 4: 82,918,226 (GRCm39) Q572L probably benign Het
Gja10 G A 4: 32,602,441 (GRCm39) probably benign Het
Gm39115 A G 7: 141,689,360 (GRCm39) C138R unknown Het
Gm7356 T A 17: 14,221,699 (GRCm39) Y110F probably benign Het
Igf2r T C 17: 12,952,747 (GRCm39) K233R probably benign Het
Igkv9-129 A T 6: 67,817,206 (GRCm39) E103D probably benign Het
Igsf11 C A 16: 38,827,586 (GRCm39) T48N probably damaging Het
Itpkc A T 7: 26,913,944 (GRCm39) Y506N probably damaging Het
Kat2a A C 11: 100,600,304 (GRCm39) M357R possibly damaging Het
Kbtbd12 T C 6: 88,595,132 (GRCm39) R233G possibly damaging Het
Kcnd2 T A 6: 21,726,197 (GRCm39) C563* probably null Het
Kcnu1 T C 8: 26,382,018 (GRCm39) V456A probably benign Het
Kif24 A G 4: 41,428,825 (GRCm39) V45A probably damaging Het
Macf1 A T 4: 123,289,414 (GRCm39) probably benign Het
Map3k19 T A 1: 127,745,007 (GRCm39) E1177D Het
Mdn1 G T 4: 32,725,107 (GRCm39) L2575F probably benign Het
Mga T A 2: 119,776,800 (GRCm39) M1569K possibly damaging Het
Mvk T C 5: 114,588,840 (GRCm39) Y161H probably damaging Het
Or10al3 T A 17: 38,012,389 (GRCm39) M276K probably benign Het
Or14c44 G T 7: 86,061,987 (GRCm39) C139F probably damaging Het
Or2n1 C A 17: 38,486,464 (GRCm39) T163K probably damaging Het
Pcdhb14 T A 18: 37,583,075 (GRCm39) V727E possibly damaging Het
Pcsk7 T G 9: 45,821,707 (GRCm39) V167G probably damaging Het
Plin5 T C 17: 56,422,221 (GRCm39) D146G probably benign Het
Plxna4 C T 6: 32,188,000 (GRCm39) G879R possibly damaging Het
Prss58 C T 6: 40,872,594 (GRCm39) A171T probably benign Het
Pum1 A G 4: 130,499,231 (GRCm39) I1016V probably benign Het
Rbm43 A G 2: 51,816,712 (GRCm39) V85A probably damaging Het
Rdh16f2 T A 10: 127,712,864 (GRCm39) D287E probably damaging Het
Rptor T A 11: 119,702,812 (GRCm39) L393Q probably damaging Het
Sbf2 T G 7: 109,970,825 (GRCm39) H857P possibly damaging Het
Scn8a A C 15: 100,938,387 (GRCm39) T1919P probably benign Het
Sema6b C T 17: 56,434,084 (GRCm39) G377E probably damaging Het
Senp7 T A 16: 55,975,603 (GRCm39) D436E probably damaging Het
Slc6a17 T A 3: 107,380,901 (GRCm39) I535F probably benign Het
Sptbn2 T A 19: 4,779,158 (GRCm39) S281T possibly damaging Het
Stt3b T C 9: 115,083,999 (GRCm39) I392M probably damaging Het
Tfap2b T C 1: 19,296,660 (GRCm39) V201A possibly damaging Het
Timm10b T C 7: 105,289,876 (GRCm39) probably benign Het
Ttc23 A C 7: 67,312,135 (GRCm39) D14A probably damaging Het
Usp32 A T 11: 84,923,011 (GRCm39) L636I possibly damaging Het
Vgll4 G T 6: 114,867,613 (GRCm39) H79Q probably damaging Het
Vps13d A G 4: 144,818,858 (GRCm39) I3047T Het
Zan T C 5: 137,448,813 (GRCm39) E1680G unknown Het
Other mutations in Fam117b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Fam117b APN 1 60,008,177 (GRCm39) missense probably damaging 0.99
IGL01596:Fam117b APN 1 59,992,130 (GRCm39) nonsense probably null
IGL02104:Fam117b APN 1 59,988,278 (GRCm39) missense probably benign 0.36
IGL02129:Fam117b APN 1 60,020,582 (GRCm39) missense probably benign 0.07
IGL03387:Fam117b APN 1 59,992,119 (GRCm39) missense probably benign 0.26
R0690:Fam117b UTSW 1 59,997,512 (GRCm39) missense possibly damaging 0.65
R1074:Fam117b UTSW 1 59,997,485 (GRCm39) missense possibly damaging 0.88
R1435:Fam117b UTSW 1 60,008,222 (GRCm39) missense possibly damaging 0.80
R2215:Fam117b UTSW 1 60,008,219 (GRCm39) missense probably damaging 1.00
R2267:Fam117b UTSW 1 59,952,789 (GRCm39) missense probably damaging 1.00
R2268:Fam117b UTSW 1 59,952,789 (GRCm39) missense probably damaging 1.00
R5765:Fam117b UTSW 1 60,009,631 (GRCm39) splice site probably null
R6228:Fam117b UTSW 1 60,008,207 (GRCm39) missense probably damaging 1.00
R6439:Fam117b UTSW 1 60,020,731 (GRCm39) missense probably benign 0.45
R6921:Fam117b UTSW 1 59,992,094 (GRCm39) missense probably damaging 1.00
R7633:Fam117b UTSW 1 60,020,693 (GRCm39) missense probably damaging 1.00
R7827:Fam117b UTSW 1 59,952,837 (GRCm39) missense possibly damaging 0.94
R7867:Fam117b UTSW 1 60,014,046 (GRCm39) missense probably damaging 0.98
R9116:Fam117b UTSW 1 60,018,456 (GRCm39) nonsense probably null
R9368:Fam117b UTSW 1 60,020,740 (GRCm39) missense probably benign 0.12
X0004:Fam117b UTSW 1 60,014,137 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCCGTTCCAGCTGAAGC -3'
(R):5'- AAATTGAGCCCAGGCCCAAG -3'

Sequencing Primer
(F):5'- GCAGCAACATGGCAGCC -3'
(R):5'- AGCCCAGGCCCAAGGTTAG -3'
Posted On 2020-07-28