Incidental Mutation 'R8305:Dennd1a'
ID 640975
Institutional Source Beutler Lab
Gene Symbol Dennd1a
Ensembl Gene ENSMUSG00000035392
Gene Name DENN/MADD domain containing 1A
Synonyms 6030446I19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock # R8305 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 37798991-38287390 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 37858081 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 375 (L375F)
Ref Sequence ENSEMBL: ENSMUSP00000099848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102787] [ENSMUST00000140552]
AlphaFold Q8K382
Predicted Effect probably damaging
Transcript: ENSMUST00000102787
AA Change: L375F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099848
Gene: ENSMUSG00000035392
AA Change: L375F

DomainStartEndE-ValueType
uDENN 9 91 1.44e-26 SMART
DENN 92 273 2.09e-73 SMART
dDENN 304 371 1.37e-18 SMART
low complexity region 497 508 N/A INTRINSIC
low complexity region 689 702 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 772 786 N/A INTRINSIC
low complexity region 801 815 N/A INTRINSIC
low complexity region 822 856 N/A INTRINSIC
low complexity region 952 972 N/A INTRINSIC
low complexity region 991 1004 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140552
Meta Mutation Damage Score 0.2242 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin (see MIM 118955)-mediated endocytosis is a major mechanism for internalization of proteins and lipids. Members of the connecdenn family, such as DENND1A, function as guanine nucleotide exchange factors (GEFs) for the early endosomal small GTPase RAB35 (MIM 604199) and bind to clathrin and clathrin adaptor protein-2 (AP2; see MIM 601024). Thus, connecdenns link RAB35 activation with the clathrin machinery (Marat and McPherson, 2010 [PubMed 20154091]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,971,395 E243K possibly damaging Het
Accsl A T 2: 93,866,078 H58Q probably benign Het
Actl7a T A 4: 56,743,744 F90L probably benign Het
Adam5 G A 8: 24,810,703 A270V possibly damaging Het
Angptl3 A G 4: 99,031,311 T103A probably damaging Het
Ankhd1 T C 18: 36,647,166 L1757P possibly damaging Het
Apoa4 T A 9: 46,241,155 M1K probably null Het
Arih1 T A 9: 59,396,487 Q445L probably benign Het
Asb14 A T 14: 26,912,097 I420L probably benign Het
Bbs2 A C 8: 94,074,325 V626G probably damaging Het
BC089597 T A 10: 127,876,995 D287E probably damaging Het
Cep290 C A 10: 100,544,934 A1678D probably benign Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Clca3a1 C T 3: 144,759,166 probably benign Het
Clca3b T A 3: 144,825,937 N702I probably damaging Het
Col24a1 T C 3: 145,474,182 V1143A probably benign Het
Cux1 T C 5: 136,360,009 T223A probably benign Het
Defa30 A T 8: 21,135,459 T80S probably benign Het
Dnajc6 C T 4: 101,623,787 T675I probably damaging Het
Emc9 A G 14: 55,585,099 V4A probably damaging Het
Enpp3 C G 10: 24,824,929 probably null Het
Fam117b A G 1: 59,913,623 T154A probably benign Het
Filip1 G T 9: 79,820,475 Y287* probably null Het
Flt3 T C 5: 147,348,054 D751G probably damaging Het
Frem1 T A 4: 82,999,989 Q572L probably benign Het
Gja10 G A 4: 32,602,441 probably benign Het
Gm7356 T A 17: 14,001,437 Y110F probably benign Het
Igf2r T C 17: 12,733,860 K233R probably benign Het
Igkv9-129 A T 6: 67,840,222 E103D probably benign Het
Igsf11 C A 16: 39,007,224 T48N probably damaging Het
Itpkc A T 7: 27,214,519 Y506N probably damaging Het
Kat2a A C 11: 100,709,478 M357R possibly damaging Het
Kbtbd12 T C 6: 88,618,150 R233G possibly damaging Het
Kcnd2 T A 6: 21,726,198 C563* probably null Het
Kcnu1 T C 8: 25,891,990 V456A probably benign Het
Kif24 A G 4: 41,428,825 V45A probably damaging Het
Macf1 A T 4: 123,395,621 probably benign Het
Map3k19 T A 1: 127,817,270 E1177D Het
Mdn1 G T 4: 32,725,107 L2575F probably benign Het
Mga T A 2: 119,946,319 M1569K possibly damaging Het
Mvk T C 5: 114,450,779 Y161H probably damaging Het
Olfr119 T A 17: 37,701,498 M276K probably benign Het
Olfr134 C A 17: 38,175,573 T163K probably damaging Het
Olfr301 G T 7: 86,412,779 C139F probably damaging Het
Pcdhb14 T A 18: 37,450,022 V727E possibly damaging Het
Pcsk7 T G 9: 45,910,409 V167G probably damaging Het
Plin5 T C 17: 56,115,221 D146G probably benign Het
Plxna4 C T 6: 32,211,065 G879R possibly damaging Het
Prss58 C T 6: 40,895,660 A171T probably benign Het
Pum1 A G 4: 130,771,920 I1016V probably benign Het
Rbm43 A G 2: 51,926,700 V85A probably damaging Het
RP23-56A14.9 A G 7: 142,135,623 C138R unknown Het
Rptor T A 11: 119,811,986 L393Q probably damaging Het
Sbf2 T G 7: 110,371,618 H857P possibly damaging Het
Scn8a A C 15: 101,040,506 T1919P probably benign Het
Sema6b C T 17: 56,127,084 G377E probably damaging Het
Senp7 T A 16: 56,155,240 D436E probably damaging Het
Slc6a17 T A 3: 107,473,585 I535F probably benign Het
Sptbn2 T A 19: 4,729,130 S281T possibly damaging Het
Stt3b T C 9: 115,254,931 I392M probably damaging Het
Tfap2b T C 1: 19,226,436 V201A possibly damaging Het
Timm10b T C 7: 105,640,669 probably benign Het
Ttc23 A C 7: 67,662,387 D14A probably damaging Het
Usp32 A T 11: 85,032,185 L636I possibly damaging Het
Vgll4 G T 6: 114,890,652 H79Q probably damaging Het
Vps13d A G 4: 145,092,288 I3047T Het
Zan T C 5: 137,450,551 E1680G unknown Het
Other mutations in Dennd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dennd1a APN 2 38243442 nonsense probably null
IGL00490:Dennd1a APN 2 37801152 missense probably damaging 1.00
IGL00839:Dennd1a APN 2 37816982 missense probably benign 0.30
IGL01065:Dennd1a APN 2 37844905 missense probably benign 0.02
IGL01621:Dennd1a APN 2 37844809 missense probably damaging 1.00
IGL01792:Dennd1a APN 2 38126580 missense probably damaging 1.00
IGL01799:Dennd1a APN 2 38048742 missense probably damaging 1.00
IGL02516:Dennd1a APN 2 37852394 critical splice donor site probably null
contract UTSW 2 37852441 missense possibly damaging 0.89
R0018:Dennd1a UTSW 2 37858460 missense possibly damaging 0.72
R0018:Dennd1a UTSW 2 37858460 missense possibly damaging 0.72
R0144:Dennd1a UTSW 2 38126640 missense probably damaging 0.96
R0784:Dennd1a UTSW 2 38021414 missense probably damaging 1.00
R1199:Dennd1a UTSW 2 37961716 missense probably damaging 0.99
R1439:Dennd1a UTSW 2 38043400 missense probably damaging 1.00
R1563:Dennd1a UTSW 2 37858429 missense probably damaging 1.00
R1608:Dennd1a UTSW 2 37852434 missense probably benign 0.18
R1720:Dennd1a UTSW 2 37800197 nonsense probably null
R1967:Dennd1a UTSW 2 37844833 missense probably benign
R2570:Dennd1a UTSW 2 37844783 missense probably damaging 1.00
R3886:Dennd1a UTSW 2 37858077 missense possibly damaging 0.89
R4464:Dennd1a UTSW 2 38243390 splice site probably benign
R4890:Dennd1a UTSW 2 38176226 intron probably benign
R5395:Dennd1a UTSW 2 37802128 missense probably damaging 1.00
R5652:Dennd1a UTSW 2 37801126 missense probably benign 0.00
R5882:Dennd1a UTSW 2 37961663 missense probably damaging 1.00
R6285:Dennd1a UTSW 2 37852441 missense possibly damaging 0.89
R6520:Dennd1a UTSW 2 37961747 splice site probably null
R6934:Dennd1a UTSW 2 37801213 missense possibly damaging 0.62
R7053:Dennd1a UTSW 2 37961654 missense probably damaging 1.00
R7109:Dennd1a UTSW 2 38048792 missense probably damaging 1.00
R7204:Dennd1a UTSW 2 38039203 missense probably damaging 1.00
R7235:Dennd1a UTSW 2 37801061 missense probably benign
R7408:Dennd1a UTSW 2 37852172 splice site probably null
R7446:Dennd1a UTSW 2 37816979 missense possibly damaging 0.89
R7579:Dennd1a UTSW 2 37858432 missense probably damaging 0.99
R7645:Dennd1a UTSW 2 38021363 missense probably damaging 1.00
R7661:Dennd1a UTSW 2 37844829 missense probably benign
R8132:Dennd1a UTSW 2 37858060 missense probably damaging 1.00
R8369:Dennd1a UTSW 2 38048754 missense probably damaging 1.00
R8418:Dennd1a UTSW 2 37858391 missense probably benign 0.36
R8438:Dennd1a UTSW 2 37856138 missense probably benign 0.08
R8544:Dennd1a UTSW 2 37982908 splice site probably null
R8997:Dennd1a UTSW 2 37800485 missense probably benign 0.14
R9052:Dennd1a UTSW 2 38021451 missense probably damaging 1.00
R9087:Dennd1a UTSW 2 38021354 critical splice donor site probably null
R9096:Dennd1a UTSW 2 37800065 missense probably damaging 1.00
R9346:Dennd1a UTSW 2 38021435 missense probably benign 0.12
Z1088:Dennd1a UTSW 2 37800692 missense probably benign
Z1177:Dennd1a UTSW 2 37800257 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGCATCCTGTCACAAAACAG -3'
(R):5'- TACCTTTGGCACTAAGAATGGGG -3'

Sequencing Primer
(F):5'- TGTCACAAAACAGGGAATTTCC -3'
(R):5'- GGCCTAGAGAGGACCAGTG -3'
Posted On 2020-07-28