Incidental Mutation 'R8305:Dennd1a'
ID 640975
Institutional Source Beutler Lab
Gene Symbol Dennd1a
Ensembl Gene ENSMUSG00000035392
Gene Name DENN domain containing 1A
Synonyms 6030446I19Rik
MMRRC Submission 067716-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.193) question?
Stock # R8305 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 37689003-38177402 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 37748093 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 375 (L375F)
Ref Sequence ENSEMBL: ENSMUSP00000099848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102787] [ENSMUST00000140552]
AlphaFold Q8K382
Predicted Effect probably damaging
Transcript: ENSMUST00000102787
AA Change: L375F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099848
Gene: ENSMUSG00000035392
AA Change: L375F

DomainStartEndE-ValueType
uDENN 9 91 1.44e-26 SMART
DENN 92 273 2.09e-73 SMART
dDENN 304 371 1.37e-18 SMART
low complexity region 497 508 N/A INTRINSIC
low complexity region 689 702 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 772 786 N/A INTRINSIC
low complexity region 801 815 N/A INTRINSIC
low complexity region 822 856 N/A INTRINSIC
low complexity region 952 972 N/A INTRINSIC
low complexity region 991 1004 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140552
Meta Mutation Damage Score 0.2242 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin (see MIM 118955)-mediated endocytosis is a major mechanism for internalization of proteins and lipids. Members of the connecdenn family, such as DENND1A, function as guanine nucleotide exchange factors (GEFs) for the early endosomal small GTPase RAB35 (MIM 604199) and bind to clathrin and clathrin adaptor protein-2 (AP2; see MIM 601024). Thus, connecdenns link RAB35 activation with the clathrin machinery (Marat and McPherson, 2010 [PubMed 20154091]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 64,208,844 (GRCm39) E243K possibly damaging Het
Accsl A T 2: 93,696,423 (GRCm39) H58Q probably benign Het
Actl7a T A 4: 56,743,744 (GRCm39) F90L probably benign Het
Adam5 G A 8: 25,300,719 (GRCm39) A270V possibly damaging Het
Angptl3 A G 4: 98,919,548 (GRCm39) T103A probably damaging Het
Ankhd1 T C 18: 36,780,219 (GRCm39) L1757P possibly damaging Het
Apoa4 T A 9: 46,152,453 (GRCm39) M1K probably null Het
Arih1 T A 9: 59,303,770 (GRCm39) Q445L probably benign Het
Asb14 A T 14: 26,634,054 (GRCm39) I420L probably benign Het
Bbs2 A C 8: 94,800,953 (GRCm39) V626G probably damaging Het
Cep290 C A 10: 100,380,796 (GRCm39) A1678D probably benign Het
Cilp G A 9: 65,186,286 (GRCm39) G794S probably damaging Het
Clca3a1 C T 3: 144,464,927 (GRCm39) probably benign Het
Clca3b T A 3: 144,531,698 (GRCm39) N702I probably damaging Het
Col24a1 T C 3: 145,179,937 (GRCm39) V1143A probably benign Het
Cux1 T C 5: 136,388,863 (GRCm39) T223A probably benign Het
Defa30 A T 8: 21,625,475 (GRCm39) T80S probably benign Het
Dnajc6 C T 4: 101,480,984 (GRCm39) T675I probably damaging Het
Emc9 A G 14: 55,822,556 (GRCm39) V4A probably damaging Het
Enpp3 C G 10: 24,700,827 (GRCm39) probably null Het
Fam117b A G 1: 59,952,782 (GRCm39) T154A probably benign Het
Filip1 G T 9: 79,727,757 (GRCm39) Y287* probably null Het
Flt3 T C 5: 147,284,864 (GRCm39) D751G probably damaging Het
Frem1 T A 4: 82,918,226 (GRCm39) Q572L probably benign Het
Gja10 G A 4: 32,602,441 (GRCm39) probably benign Het
Gm39115 A G 7: 141,689,360 (GRCm39) C138R unknown Het
Gm7356 T A 17: 14,221,699 (GRCm39) Y110F probably benign Het
Igf2r T C 17: 12,952,747 (GRCm39) K233R probably benign Het
Igkv9-129 A T 6: 67,817,206 (GRCm39) E103D probably benign Het
Igsf11 C A 16: 38,827,586 (GRCm39) T48N probably damaging Het
Itpkc A T 7: 26,913,944 (GRCm39) Y506N probably damaging Het
Kat2a A C 11: 100,600,304 (GRCm39) M357R possibly damaging Het
Kbtbd12 T C 6: 88,595,132 (GRCm39) R233G possibly damaging Het
Kcnd2 T A 6: 21,726,197 (GRCm39) C563* probably null Het
Kcnu1 T C 8: 26,382,018 (GRCm39) V456A probably benign Het
Kif24 A G 4: 41,428,825 (GRCm39) V45A probably damaging Het
Macf1 A T 4: 123,289,414 (GRCm39) probably benign Het
Map3k19 T A 1: 127,745,007 (GRCm39) E1177D Het
Mdn1 G T 4: 32,725,107 (GRCm39) L2575F probably benign Het
Mga T A 2: 119,776,800 (GRCm39) M1569K possibly damaging Het
Mvk T C 5: 114,588,840 (GRCm39) Y161H probably damaging Het
Or10al3 T A 17: 38,012,389 (GRCm39) M276K probably benign Het
Or14c44 G T 7: 86,061,987 (GRCm39) C139F probably damaging Het
Or2n1 C A 17: 38,486,464 (GRCm39) T163K probably damaging Het
Pcdhb14 T A 18: 37,583,075 (GRCm39) V727E possibly damaging Het
Pcsk7 T G 9: 45,821,707 (GRCm39) V167G probably damaging Het
Plin5 T C 17: 56,422,221 (GRCm39) D146G probably benign Het
Plxna4 C T 6: 32,188,000 (GRCm39) G879R possibly damaging Het
Prss58 C T 6: 40,872,594 (GRCm39) A171T probably benign Het
Pum1 A G 4: 130,499,231 (GRCm39) I1016V probably benign Het
Rbm43 A G 2: 51,816,712 (GRCm39) V85A probably damaging Het
Rdh16f2 T A 10: 127,712,864 (GRCm39) D287E probably damaging Het
Rptor T A 11: 119,702,812 (GRCm39) L393Q probably damaging Het
Sbf2 T G 7: 109,970,825 (GRCm39) H857P possibly damaging Het
Scn8a A C 15: 100,938,387 (GRCm39) T1919P probably benign Het
Sema6b C T 17: 56,434,084 (GRCm39) G377E probably damaging Het
Senp7 T A 16: 55,975,603 (GRCm39) D436E probably damaging Het
Slc6a17 T A 3: 107,380,901 (GRCm39) I535F probably benign Het
Sptbn2 T A 19: 4,779,158 (GRCm39) S281T possibly damaging Het
Stt3b T C 9: 115,083,999 (GRCm39) I392M probably damaging Het
Tfap2b T C 1: 19,296,660 (GRCm39) V201A possibly damaging Het
Timm10b T C 7: 105,289,876 (GRCm39) probably benign Het
Ttc23 A C 7: 67,312,135 (GRCm39) D14A probably damaging Het
Usp32 A T 11: 84,923,011 (GRCm39) L636I possibly damaging Het
Vgll4 G T 6: 114,867,613 (GRCm39) H79Q probably damaging Het
Vps13d A G 4: 144,818,858 (GRCm39) I3047T Het
Zan T C 5: 137,448,813 (GRCm39) E1680G unknown Het
Other mutations in Dennd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dennd1a APN 2 38,133,454 (GRCm39) nonsense probably null
IGL00490:Dennd1a APN 2 37,691,164 (GRCm39) missense probably damaging 1.00
IGL00839:Dennd1a APN 2 37,706,994 (GRCm39) missense probably benign 0.30
IGL01065:Dennd1a APN 2 37,734,917 (GRCm39) missense probably benign 0.02
IGL01621:Dennd1a APN 2 37,734,821 (GRCm39) missense probably damaging 1.00
IGL01792:Dennd1a APN 2 38,016,592 (GRCm39) missense probably damaging 1.00
IGL01799:Dennd1a APN 2 37,938,754 (GRCm39) missense probably damaging 1.00
IGL02516:Dennd1a APN 2 37,742,406 (GRCm39) critical splice donor site probably null
contract UTSW 2 37,742,453 (GRCm39) missense possibly damaging 0.89
R0018:Dennd1a UTSW 2 37,748,472 (GRCm39) missense possibly damaging 0.72
R0018:Dennd1a UTSW 2 37,748,472 (GRCm39) missense possibly damaging 0.72
R0144:Dennd1a UTSW 2 38,016,652 (GRCm39) missense probably damaging 0.96
R0784:Dennd1a UTSW 2 37,911,426 (GRCm39) missense probably damaging 1.00
R1199:Dennd1a UTSW 2 37,851,728 (GRCm39) missense probably damaging 0.99
R1439:Dennd1a UTSW 2 37,933,412 (GRCm39) missense probably damaging 1.00
R1563:Dennd1a UTSW 2 37,748,441 (GRCm39) missense probably damaging 1.00
R1608:Dennd1a UTSW 2 37,742,446 (GRCm39) missense probably benign 0.18
R1720:Dennd1a UTSW 2 37,690,209 (GRCm39) nonsense probably null
R1967:Dennd1a UTSW 2 37,734,845 (GRCm39) missense probably benign
R2570:Dennd1a UTSW 2 37,734,795 (GRCm39) missense probably damaging 1.00
R3886:Dennd1a UTSW 2 37,748,089 (GRCm39) missense possibly damaging 0.89
R4464:Dennd1a UTSW 2 38,133,402 (GRCm39) splice site probably benign
R4890:Dennd1a UTSW 2 38,066,238 (GRCm39) intron probably benign
R5395:Dennd1a UTSW 2 37,692,140 (GRCm39) missense probably damaging 1.00
R5652:Dennd1a UTSW 2 37,691,138 (GRCm39) missense probably benign 0.00
R5882:Dennd1a UTSW 2 37,851,675 (GRCm39) missense probably damaging 1.00
R6285:Dennd1a UTSW 2 37,742,453 (GRCm39) missense possibly damaging 0.89
R6520:Dennd1a UTSW 2 37,851,759 (GRCm39) splice site probably null
R6934:Dennd1a UTSW 2 37,691,225 (GRCm39) missense possibly damaging 0.62
R7053:Dennd1a UTSW 2 37,851,666 (GRCm39) missense probably damaging 1.00
R7109:Dennd1a UTSW 2 37,938,804 (GRCm39) missense probably damaging 1.00
R7204:Dennd1a UTSW 2 37,929,215 (GRCm39) missense probably damaging 1.00
R7235:Dennd1a UTSW 2 37,691,073 (GRCm39) missense probably benign
R7408:Dennd1a UTSW 2 37,742,184 (GRCm39) splice site probably null
R7446:Dennd1a UTSW 2 37,706,991 (GRCm39) missense possibly damaging 0.89
R7579:Dennd1a UTSW 2 37,748,444 (GRCm39) missense probably damaging 0.99
R7645:Dennd1a UTSW 2 37,911,375 (GRCm39) missense probably damaging 1.00
R7661:Dennd1a UTSW 2 37,734,841 (GRCm39) missense probably benign
R8132:Dennd1a UTSW 2 37,748,072 (GRCm39) missense probably damaging 1.00
R8369:Dennd1a UTSW 2 37,938,766 (GRCm39) missense probably damaging 1.00
R8418:Dennd1a UTSW 2 37,748,403 (GRCm39) missense probably benign 0.36
R8438:Dennd1a UTSW 2 37,746,150 (GRCm39) missense probably benign 0.08
R8544:Dennd1a UTSW 2 37,872,920 (GRCm39) splice site probably null
R8997:Dennd1a UTSW 2 37,690,497 (GRCm39) missense probably benign 0.14
R9052:Dennd1a UTSW 2 37,911,463 (GRCm39) missense probably damaging 1.00
R9087:Dennd1a UTSW 2 37,911,366 (GRCm39) critical splice donor site probably null
R9096:Dennd1a UTSW 2 37,690,077 (GRCm39) missense probably damaging 1.00
R9346:Dennd1a UTSW 2 37,911,447 (GRCm39) missense probably benign 0.12
Z1088:Dennd1a UTSW 2 37,690,704 (GRCm39) missense probably benign
Z1177:Dennd1a UTSW 2 37,690,269 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGCATCCTGTCACAAAACAG -3'
(R):5'- TACCTTTGGCACTAAGAATGGGG -3'

Sequencing Primer
(F):5'- TGTCACAAAACAGGGAATTTCC -3'
(R):5'- GGCCTAGAGAGGACCAGTG -3'
Posted On 2020-07-28