Incidental Mutation 'R8305:Mga'
ID 640978
Institutional Source Beutler Lab
Gene Symbol Mga
Ensembl Gene ENSMUSG00000033943
Gene Name MAX gene associated
Synonyms Mga, C130042M01Rik, Mad5, D030062C11Rik
MMRRC Submission 067716-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.953) question?
Stock # R8305 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 119727709-119800062 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 119776800 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1569 (M1569K)
Ref Sequence ENSEMBL: ENSMUSP00000119044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046717] [ENSMUST00000079934] [ENSMUST00000110773] [ENSMUST00000110774] [ENSMUST00000156510]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000046717
SMART Domains Protein: ENSMUSP00000043795
Gene: ENSMUSG00000033943

DomainStartEndE-ValueType
Blast:TBOX 6 73 6e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1796 1818 N/A INTRINSIC
low complexity region 1833 1850 N/A INTRINSIC
low complexity region 1977 1992 N/A INTRINSIC
low complexity region 2183 2197 N/A INTRINSIC
low complexity region 2241 2259 N/A INTRINSIC
HLH 2368 2419 8.27e-7 SMART
low complexity region 2748 2769 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000079934
AA Change: M1569K

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078853
Gene: ENSMUSG00000033943
AA Change: M1569K

DomainStartEndE-ValueType
Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
low complexity region 2578 2599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110773
SMART Domains Protein: ENSMUSP00000106400
Gene: ENSMUSG00000033943

DomainStartEndE-ValueType
Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 890 899 N/A INTRINSIC
low complexity region 938 952 N/A INTRINSIC
low complexity region 1033 1059 N/A INTRINSIC
low complexity region 1169 1190 N/A INTRINSIC
low complexity region 1222 1236 N/A INTRINSIC
low complexity region 1485 1502 N/A INTRINSIC
low complexity region 1555 1570 N/A INTRINSIC
low complexity region 1602 1637 N/A INTRINSIC
low complexity region 1717 1739 N/A INTRINSIC
low complexity region 1754 1771 N/A INTRINSIC
low complexity region 1898 1913 N/A INTRINSIC
low complexity region 2104 2118 N/A INTRINSIC
low complexity region 2162 2180 N/A INTRINSIC
HLH 2289 2340 8.27e-7 SMART
low complexity region 2669 2690 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110774
AA Change: M1778K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106401
Gene: ENSMUSG00000033943
AA Change: M1778K

DomainStartEndE-ValueType
Blast:TBOX 6 73 7e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
Pfam:DUF4801 1037 1085 1e-19 PFAM
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1835 1857 N/A INTRINSIC
low complexity region 1872 1889 N/A INTRINSIC
low complexity region 2016 2031 N/A INTRINSIC
low complexity region 2222 2236 N/A INTRINSIC
low complexity region 2280 2298 N/A INTRINSIC
HLH 2407 2458 8.27e-7 SMART
low complexity region 2787 2808 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000156510
AA Change: M1569K

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000119044
Gene: ENSMUSG00000033943
AA Change: M1569K

DomainStartEndE-ValueType
Blast:TBOX 6 73 4e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (65/66)
MGI Phenotype PHENOTYPE: Embryos homozygous for a gene trap allele die shortly after implantation due to defective development of the inner cell mass (ICM) and the epiblast. ICM derivatives fail to develop past E4.5 and show increased apoptosis but no change in cell proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(135) : Gene trapped(135)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 64,208,844 (GRCm39) E243K possibly damaging Het
Accsl A T 2: 93,696,423 (GRCm39) H58Q probably benign Het
Actl7a T A 4: 56,743,744 (GRCm39) F90L probably benign Het
Adam5 G A 8: 25,300,719 (GRCm39) A270V possibly damaging Het
Angptl3 A G 4: 98,919,548 (GRCm39) T103A probably damaging Het
Ankhd1 T C 18: 36,780,219 (GRCm39) L1757P possibly damaging Het
Apoa4 T A 9: 46,152,453 (GRCm39) M1K probably null Het
Arih1 T A 9: 59,303,770 (GRCm39) Q445L probably benign Het
Asb14 A T 14: 26,634,054 (GRCm39) I420L probably benign Het
Bbs2 A C 8: 94,800,953 (GRCm39) V626G probably damaging Het
Cep290 C A 10: 100,380,796 (GRCm39) A1678D probably benign Het
Cilp G A 9: 65,186,286 (GRCm39) G794S probably damaging Het
Clca3a1 C T 3: 144,464,927 (GRCm39) probably benign Het
Clca3b T A 3: 144,531,698 (GRCm39) N702I probably damaging Het
Col24a1 T C 3: 145,179,937 (GRCm39) V1143A probably benign Het
Cux1 T C 5: 136,388,863 (GRCm39) T223A probably benign Het
Defa30 A T 8: 21,625,475 (GRCm39) T80S probably benign Het
Dennd1a G A 2: 37,748,093 (GRCm39) L375F probably damaging Het
Dnajc6 C T 4: 101,480,984 (GRCm39) T675I probably damaging Het
Emc9 A G 14: 55,822,556 (GRCm39) V4A probably damaging Het
Enpp3 C G 10: 24,700,827 (GRCm39) probably null Het
Fam117b A G 1: 59,952,782 (GRCm39) T154A probably benign Het
Filip1 G T 9: 79,727,757 (GRCm39) Y287* probably null Het
Flt3 T C 5: 147,284,864 (GRCm39) D751G probably damaging Het
Frem1 T A 4: 82,918,226 (GRCm39) Q572L probably benign Het
Gja10 G A 4: 32,602,441 (GRCm39) probably benign Het
Gm39115 A G 7: 141,689,360 (GRCm39) C138R unknown Het
Gm7356 T A 17: 14,221,699 (GRCm39) Y110F probably benign Het
Igf2r T C 17: 12,952,747 (GRCm39) K233R probably benign Het
Igkv9-129 A T 6: 67,817,206 (GRCm39) E103D probably benign Het
Igsf11 C A 16: 38,827,586 (GRCm39) T48N probably damaging Het
Itpkc A T 7: 26,913,944 (GRCm39) Y506N probably damaging Het
Kat2a A C 11: 100,600,304 (GRCm39) M357R possibly damaging Het
Kbtbd12 T C 6: 88,595,132 (GRCm39) R233G possibly damaging Het
Kcnd2 T A 6: 21,726,197 (GRCm39) C563* probably null Het
Kcnu1 T C 8: 26,382,018 (GRCm39) V456A probably benign Het
Kif24 A G 4: 41,428,825 (GRCm39) V45A probably damaging Het
Macf1 A T 4: 123,289,414 (GRCm39) probably benign Het
Map3k19 T A 1: 127,745,007 (GRCm39) E1177D Het
Mdn1 G T 4: 32,725,107 (GRCm39) L2575F probably benign Het
Mvk T C 5: 114,588,840 (GRCm39) Y161H probably damaging Het
Or10al3 T A 17: 38,012,389 (GRCm39) M276K probably benign Het
Or14c44 G T 7: 86,061,987 (GRCm39) C139F probably damaging Het
Or2n1 C A 17: 38,486,464 (GRCm39) T163K probably damaging Het
Pcdhb14 T A 18: 37,583,075 (GRCm39) V727E possibly damaging Het
Pcsk7 T G 9: 45,821,707 (GRCm39) V167G probably damaging Het
Plin5 T C 17: 56,422,221 (GRCm39) D146G probably benign Het
Plxna4 C T 6: 32,188,000 (GRCm39) G879R possibly damaging Het
Prss58 C T 6: 40,872,594 (GRCm39) A171T probably benign Het
Pum1 A G 4: 130,499,231 (GRCm39) I1016V probably benign Het
Rbm43 A G 2: 51,816,712 (GRCm39) V85A probably damaging Het
Rdh16f2 T A 10: 127,712,864 (GRCm39) D287E probably damaging Het
Rptor T A 11: 119,702,812 (GRCm39) L393Q probably damaging Het
Sbf2 T G 7: 109,970,825 (GRCm39) H857P possibly damaging Het
Scn8a A C 15: 100,938,387 (GRCm39) T1919P probably benign Het
Sema6b C T 17: 56,434,084 (GRCm39) G377E probably damaging Het
Senp7 T A 16: 55,975,603 (GRCm39) D436E probably damaging Het
Slc6a17 T A 3: 107,380,901 (GRCm39) I535F probably benign Het
Sptbn2 T A 19: 4,779,158 (GRCm39) S281T possibly damaging Het
Stt3b T C 9: 115,083,999 (GRCm39) I392M probably damaging Het
Tfap2b T C 1: 19,296,660 (GRCm39) V201A possibly damaging Het
Timm10b T C 7: 105,289,876 (GRCm39) probably benign Het
Ttc23 A C 7: 67,312,135 (GRCm39) D14A probably damaging Het
Usp32 A T 11: 84,923,011 (GRCm39) L636I possibly damaging Het
Vgll4 G T 6: 114,867,613 (GRCm39) H79Q probably damaging Het
Vps13d A G 4: 144,818,858 (GRCm39) I3047T Het
Zan T C 5: 137,448,813 (GRCm39) E1680G unknown Het
Other mutations in Mga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Mga APN 2 119,750,295 (GRCm39) missense possibly damaging 0.65
IGL00719:Mga APN 2 119,777,934 (GRCm39) nonsense probably null
IGL01619:Mga APN 2 119,762,309 (GRCm39) missense possibly damaging 0.46
IGL01721:Mga APN 2 119,765,720 (GRCm39) missense probably damaging 1.00
IGL01759:Mga APN 2 119,781,676 (GRCm39) missense possibly damaging 0.92
IGL01785:Mga APN 2 119,733,393 (GRCm39) missense probably damaging 1.00
IGL01786:Mga APN 2 119,733,393 (GRCm39) missense probably damaging 1.00
IGL01950:Mga APN 2 119,772,135 (GRCm39) missense possibly damaging 0.60
IGL01960:Mga APN 2 119,769,138 (GRCm39) missense probably damaging 1.00
IGL02086:Mga APN 2 119,754,517 (GRCm39) missense probably damaging 0.99
IGL02364:Mga APN 2 119,794,535 (GRCm39) missense possibly damaging 0.66
IGL02602:Mga APN 2 119,762,365 (GRCm39) missense possibly damaging 0.66
IGL02751:Mga APN 2 119,778,251 (GRCm39) missense possibly damaging 0.82
IGL02794:Mga APN 2 119,776,770 (GRCm39) missense possibly damaging 0.84
IGL03247:Mga APN 2 119,765,994 (GRCm39) missense possibly damaging 0.81
IGL03303:Mga APN 2 119,733,933 (GRCm39) missense probably damaging 1.00
PIT4515001:Mga UTSW 2 119,746,985 (GRCm39) missense probably damaging 1.00
R0060:Mga UTSW 2 119,791,442 (GRCm39) critical splice donor site probably null
R0060:Mga UTSW 2 119,791,442 (GRCm39) critical splice donor site probably null
R0417:Mga UTSW 2 119,733,271 (GRCm39) missense probably damaging 0.99
R0449:Mga UTSW 2 119,771,862 (GRCm39) missense probably damaging 1.00
R0457:Mga UTSW 2 119,746,969 (GRCm39) missense probably damaging 0.98
R0538:Mga UTSW 2 119,750,187 (GRCm39) critical splice donor site probably null
R0568:Mga UTSW 2 119,765,903 (GRCm39) missense probably damaging 1.00
R0614:Mga UTSW 2 119,794,947 (GRCm39) missense probably damaging 1.00
R0671:Mga UTSW 2 119,750,391 (GRCm39) splice site probably null
R0811:Mga UTSW 2 119,778,442 (GRCm39) missense probably damaging 0.99
R0812:Mga UTSW 2 119,778,442 (GRCm39) missense probably damaging 0.99
R0948:Mga UTSW 2 119,772,140 (GRCm39) missense possibly damaging 0.77
R1177:Mga UTSW 2 119,756,927 (GRCm39) missense probably damaging 1.00
R1445:Mga UTSW 2 119,733,179 (GRCm39) missense probably damaging 1.00
R1476:Mga UTSW 2 119,772,156 (GRCm39) missense probably damaging 0.96
R1527:Mga UTSW 2 119,747,078 (GRCm39) missense probably damaging 1.00
R1583:Mga UTSW 2 119,794,441 (GRCm39) missense possibly damaging 0.66
R1592:Mga UTSW 2 119,795,147 (GRCm39) missense possibly damaging 0.93
R1627:Mga UTSW 2 119,795,043 (GRCm39) missense probably damaging 1.00
R1658:Mga UTSW 2 119,772,170 (GRCm39) missense possibly damaging 0.63
R1677:Mga UTSW 2 119,791,333 (GRCm39) missense possibly damaging 0.92
R1887:Mga UTSW 2 119,754,098 (GRCm39) missense probably damaging 1.00
R1908:Mga UTSW 2 119,757,075 (GRCm39) missense possibly damaging 0.66
R1909:Mga UTSW 2 119,757,075 (GRCm39) missense possibly damaging 0.66
R2061:Mga UTSW 2 119,795,461 (GRCm39) unclassified probably benign
R2145:Mga UTSW 2 119,794,638 (GRCm39) missense possibly damaging 0.85
R2159:Mga UTSW 2 119,750,124 (GRCm39) missense probably damaging 0.96
R2179:Mga UTSW 2 119,790,923 (GRCm39) missense probably damaging 0.99
R2281:Mga UTSW 2 119,734,204 (GRCm39) missense probably benign
R2423:Mga UTSW 2 119,795,274 (GRCm39) missense probably damaging 1.00
R3620:Mga UTSW 2 119,747,149 (GRCm39) missense probably damaging 1.00
R3622:Mga UTSW 2 119,772,245 (GRCm39) missense probably damaging 1.00
R3624:Mga UTSW 2 119,772,245 (GRCm39) missense probably damaging 1.00
R3802:Mga UTSW 2 119,777,820 (GRCm39) missense probably damaging 0.96
R4011:Mga UTSW 2 119,762,261 (GRCm39) missense probably damaging 1.00
R4065:Mga UTSW 2 119,777,483 (GRCm39) missense probably damaging 1.00
R4520:Mga UTSW 2 119,778,579 (GRCm39) missense possibly damaging 0.85
R4649:Mga UTSW 2 119,771,974 (GRCm39) missense possibly damaging 0.81
R4660:Mga UTSW 2 119,769,104 (GRCm39) intron probably benign
R4757:Mga UTSW 2 119,734,120 (GRCm39) missense possibly damaging 0.82
R4771:Mga UTSW 2 119,794,775 (GRCm39) missense probably damaging 1.00
R4784:Mga UTSW 2 119,733,538 (GRCm39) missense probably damaging 1.00
R4866:Mga UTSW 2 119,794,535 (GRCm39) missense possibly damaging 0.66
R4900:Mga UTSW 2 119,794,535 (GRCm39) missense possibly damaging 0.66
R4952:Mga UTSW 2 119,733,782 (GRCm39) missense probably damaging 1.00
R4995:Mga UTSW 2 119,763,063 (GRCm39) nonsense probably null
R5020:Mga UTSW 2 119,781,654 (GRCm39) nonsense probably null
R5082:Mga UTSW 2 119,733,825 (GRCm39) missense probably damaging 0.98
R5208:Mga UTSW 2 119,778,462 (GRCm39) missense possibly damaging 0.83
R5454:Mga UTSW 2 119,733,810 (GRCm39) missense probably damaging 0.99
R5466:Mga UTSW 2 119,733,178 (GRCm39) missense probably damaging 1.00
R5484:Mga UTSW 2 119,747,107 (GRCm39) missense possibly damaging 0.58
R5669:Mga UTSW 2 119,733,907 (GRCm39) missense probably damaging 1.00
R5819:Mga UTSW 2 119,771,744 (GRCm39) missense possibly damaging 0.61
R5916:Mga UTSW 2 119,794,793 (GRCm39) missense probably benign 0.27
R5942:Mga UTSW 2 119,777,440 (GRCm39) missense probably benign 0.41
R6305:Mga UTSW 2 119,778,179 (GRCm39) missense probably benign 0.00
R6434:Mga UTSW 2 119,754,419 (GRCm39) missense probably damaging 0.99
R6467:Mga UTSW 2 119,776,776 (GRCm39) missense probably damaging 1.00
R6488:Mga UTSW 2 119,791,388 (GRCm39) missense probably damaging 1.00
R6630:Mga UTSW 2 119,754,140 (GRCm39) missense probably damaging 0.99
R6790:Mga UTSW 2 119,754,235 (GRCm39) missense probably damaging 0.99
R7029:Mga UTSW 2 119,754,031 (GRCm39) missense probably damaging 1.00
R7039:Mga UTSW 2 119,763,159 (GRCm39) missense probably benign 0.28
R7088:Mga UTSW 2 119,792,417 (GRCm39) missense probably damaging 1.00
R7195:Mga UTSW 2 119,747,809 (GRCm39) missense probably damaging 1.00
R7273:Mga UTSW 2 119,765,695 (GRCm39) missense probably damaging 1.00
R7286:Mga UTSW 2 119,795,269 (GRCm39) missense possibly damaging 0.93
R7346:Mga UTSW 2 119,766,008 (GRCm39) missense possibly damaging 0.56
R7383:Mga UTSW 2 119,790,821 (GRCm39) missense probably damaging 0.99
R7469:Mga UTSW 2 119,733,527 (GRCm39) missense probably damaging 1.00
R7484:Mga UTSW 2 119,776,710 (GRCm39) missense probably damaging 0.99
R7537:Mga UTSW 2 119,766,032 (GRCm39) missense probably damaging 0.97
R7781:Mga UTSW 2 119,747,838 (GRCm39) missense probably damaging 1.00
R7921:Mga UTSW 2 119,750,159 (GRCm39) missense probably damaging 1.00
R8165:Mga UTSW 2 119,777,719 (GRCm39) missense probably benign 0.12
R8226:Mga UTSW 2 119,790,866 (GRCm39) missense probably benign 0.33
R8309:Mga UTSW 2 119,791,411 (GRCm39) missense probably damaging 1.00
R8363:Mga UTSW 2 119,794,407 (GRCm39) missense probably benign 0.43
R8388:Mga UTSW 2 119,794,562 (GRCm39) missense probably benign 0.00
R8524:Mga UTSW 2 119,771,997 (GRCm39) missense probably damaging 0.97
R8693:Mga UTSW 2 119,794,407 (GRCm39) missense possibly damaging 0.65
R8837:Mga UTSW 2 119,769,272 (GRCm39) splice site probably benign
R8916:Mga UTSW 2 119,788,819 (GRCm39) missense possibly damaging 0.92
R8936:Mga UTSW 2 119,794,709 (GRCm39) missense probably damaging 1.00
R9028:Mga UTSW 2 119,778,070 (GRCm39) missense probably benign
R9145:Mga UTSW 2 119,794,493 (GRCm39) missense probably benign
R9155:Mga UTSW 2 119,757,013 (GRCm39) missense probably damaging 1.00
R9308:Mga UTSW 2 119,754,369 (GRCm39) missense possibly damaging 0.91
R9342:Mga UTSW 2 119,778,656 (GRCm39) missense probably benign
R9347:Mga UTSW 2 119,733,518 (GRCm39) missense probably damaging 1.00
R9390:Mga UTSW 2 119,794,332 (GRCm39) missense probably damaging 0.99
R9408:Mga UTSW 2 119,765,999 (GRCm39) missense possibly damaging 0.92
R9488:Mga UTSW 2 119,795,304 (GRCm39) missense possibly damaging 0.90
R9495:Mga UTSW 2 119,781,676 (GRCm39) missense possibly damaging 0.92
R9521:Mga UTSW 2 119,794,979 (GRCm39) missense probably damaging 0.99
R9780:Mga UTSW 2 119,747,253 (GRCm39) missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CGTTACTTGCAGCATTATTAGGTC -3'
(R):5'- TTCAAGGTATGTCTCCCACTTTAG -3'

Sequencing Primer
(F):5'- CTTGCAGCATTATTAGGTCTTATGTC -3'
(R):5'- TCCAGAGGTCCTGAGTTCAAATC -3'
Posted On 2020-07-28