Incidental Mutation 'R8305:Slc6a17'
ID 640979
Institutional Source Beutler Lab
Gene Symbol Slc6a17
Ensembl Gene ENSMUSG00000027894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 17
Synonyms NTT4, D130012J15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock # R8305 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 107467543-107518018 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 107473585 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 535 (I535F)
Ref Sequence ENSEMBL: ENSMUSP00000129379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029499] [ENSMUST00000168211] [ENSMUST00000169449]
AlphaFold Q8BJI1
Predicted Effect probably benign
Transcript: ENSMUST00000029499
AA Change: I532F

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029499
Gene: ENSMUSG00000027894
AA Change: I532F

DomainStartEndE-ValueType
Pfam:SNF 60 640 2.7e-227 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168211
AA Change: I494F

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131888
Gene: ENSMUSG00000027894
AA Change: I494F

DomainStartEndE-ValueType
Pfam:SNF 19 602 1.3e-225 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169449
AA Change: I535F

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129379
Gene: ENSMUSG00000027894
AA Change: I535F

DomainStartEndE-ValueType
Pfam:SNF 60 643 1.1e-225 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SLC6 family of transporters, which are responsible for the presynaptic uptake of most neurotransmitters. The encoded vesicular transporter is selective for proline, glycine, leucine and alanine. Defects in this gene are a cause of autosomal recessive mental retardation-48. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,971,395 E243K possibly damaging Het
Accsl A T 2: 93,866,078 H58Q probably benign Het
Actl7a T A 4: 56,743,744 F90L probably benign Het
Adam5 G A 8: 24,810,703 A270V possibly damaging Het
Angptl3 A G 4: 99,031,311 T103A probably damaging Het
Ankhd1 T C 18: 36,647,166 L1757P possibly damaging Het
Apoa4 T A 9: 46,241,155 M1K probably null Het
Arih1 T A 9: 59,396,487 Q445L probably benign Het
Asb14 A T 14: 26,912,097 I420L probably benign Het
Bbs2 A C 8: 94,074,325 V626G probably damaging Het
BC089597 T A 10: 127,876,995 D287E probably damaging Het
Cep290 C A 10: 100,544,934 A1678D probably benign Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Clca3a1 C T 3: 144,759,166 probably benign Het
Clca3b T A 3: 144,825,937 N702I probably damaging Het
Col24a1 T C 3: 145,474,182 V1143A probably benign Het
Cux1 T C 5: 136,360,009 T223A probably benign Het
Defa30 A T 8: 21,135,459 T80S probably benign Het
Dennd1a G A 2: 37,858,081 L375F probably damaging Het
Dnajc6 C T 4: 101,623,787 T675I probably damaging Het
Emc9 A G 14: 55,585,099 V4A probably damaging Het
Enpp3 C G 10: 24,824,929 probably null Het
Fam117b A G 1: 59,913,623 T154A probably benign Het
Filip1 G T 9: 79,820,475 Y287* probably null Het
Flt3 T C 5: 147,348,054 D751G probably damaging Het
Frem1 T A 4: 82,999,989 Q572L probably benign Het
Gja10 G A 4: 32,602,441 probably benign Het
Gm7356 T A 17: 14,001,437 Y110F probably benign Het
Igf2r T C 17: 12,733,860 K233R probably benign Het
Igkv9-129 A T 6: 67,840,222 E103D probably benign Het
Igsf11 C A 16: 39,007,224 T48N probably damaging Het
Itpkc A T 7: 27,214,519 Y506N probably damaging Het
Kat2a A C 11: 100,709,478 M357R possibly damaging Het
Kbtbd12 T C 6: 88,618,150 R233G possibly damaging Het
Kcnd2 T A 6: 21,726,198 C563* probably null Het
Kcnu1 T C 8: 25,891,990 V456A probably benign Het
Kif24 A G 4: 41,428,825 V45A probably damaging Het
Macf1 A T 4: 123,395,621 probably benign Het
Map3k19 T A 1: 127,817,270 E1177D Het
Mdn1 G T 4: 32,725,107 L2575F probably benign Het
Mga T A 2: 119,946,319 M1569K possibly damaging Het
Mvk T C 5: 114,450,779 Y161H probably damaging Het
Olfr119 T A 17: 37,701,498 M276K probably benign Het
Olfr134 C A 17: 38,175,573 T163K probably damaging Het
Olfr301 G T 7: 86,412,779 C139F probably damaging Het
Pcdhb14 T A 18: 37,450,022 V727E possibly damaging Het
Pcsk7 T G 9: 45,910,409 V167G probably damaging Het
Plin5 T C 17: 56,115,221 D146G probably benign Het
Plxna4 C T 6: 32,211,065 G879R possibly damaging Het
Prss58 C T 6: 40,895,660 A171T probably benign Het
Pum1 A G 4: 130,771,920 I1016V probably benign Het
Rbm43 A G 2: 51,926,700 V85A probably damaging Het
RP23-56A14.9 A G 7: 142,135,623 C138R unknown Het
Rptor T A 11: 119,811,986 L393Q probably damaging Het
Sbf2 T G 7: 110,371,618 H857P possibly damaging Het
Scn8a A C 15: 101,040,506 T1919P probably benign Het
Sema6b C T 17: 56,127,084 G377E probably damaging Het
Senp7 T A 16: 56,155,240 D436E probably damaging Het
Sptbn2 T A 19: 4,729,130 S281T possibly damaging Het
Stt3b T C 9: 115,254,931 I392M probably damaging Het
Tfap2b T C 1: 19,226,436 V201A possibly damaging Het
Timm10b T C 7: 105,640,669 probably benign Het
Ttc23 A C 7: 67,662,387 D14A probably damaging Het
Usp32 A T 11: 85,032,185 L636I possibly damaging Het
Vgll4 G T 6: 114,890,652 H79Q probably damaging Het
Vps13d A G 4: 145,092,288 I3047T Het
Zan T C 5: 137,450,551 E1680G unknown Het
Other mutations in Slc6a17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02432:Slc6a17 APN 3 107493177 missense possibly damaging 0.56
IGL02514:Slc6a17 APN 3 107495677 missense possibly damaging 0.94
IGL03395:Slc6a17 APN 3 107477306 missense probably damaging 1.00
BB002:Slc6a17 UTSW 3 107495740 missense probably damaging 1.00
BB012:Slc6a17 UTSW 3 107495740 missense probably damaging 1.00
R0454:Slc6a17 UTSW 3 107476867 missense probably benign 0.12
R1201:Slc6a17 UTSW 3 107493072 missense possibly damaging 0.90
R1551:Slc6a17 UTSW 3 107472127 missense possibly damaging 0.85
R1681:Slc6a17 UTSW 3 107474386 missense probably damaging 1.00
R1721:Slc6a17 UTSW 3 107472176 missense probably damaging 1.00
R1765:Slc6a17 UTSW 3 107473579 missense possibly damaging 0.95
R1867:Slc6a17 UTSW 3 107472176 missense probably damaging 1.00
R2167:Slc6a17 UTSW 3 107491501 nonsense probably null
R3708:Slc6a17 UTSW 3 107493085 missense probably benign
R3814:Slc6a17 UTSW 3 107471317 missense possibly damaging 0.92
R4639:Slc6a17 UTSW 3 107474281 missense probably benign
R4807:Slc6a17 UTSW 3 107500487 missense possibly damaging 0.90
R5048:Slc6a17 UTSW 3 107471437 nonsense probably null
R6076:Slc6a17 UTSW 3 107472071 missense possibly damaging 0.67
R6326:Slc6a17 UTSW 3 107500406 missense probably damaging 0.98
R6713:Slc6a17 UTSW 3 107471387 missense probably benign 0.00
R7073:Slc6a17 UTSW 3 107471439 missense probably benign 0.00
R7097:Slc6a17 UTSW 3 107493148 missense probably damaging 1.00
R7323:Slc6a17 UTSW 3 107491478 missense probably benign 0.01
R7597:Slc6a17 UTSW 3 107471352 missense possibly damaging 0.89
R7755:Slc6a17 UTSW 3 107474355 missense probably damaging 1.00
R7841:Slc6a17 UTSW 3 107476898 missense possibly damaging 0.69
R7925:Slc6a17 UTSW 3 107495740 missense probably damaging 1.00
R8041:Slc6a17 UTSW 3 107474428 missense probably damaging 1.00
R8306:Slc6a17 UTSW 3 107473669 missense probably benign
R8488:Slc6a17 UTSW 3 107477258 missense possibly damaging 0.84
R8930:Slc6a17 UTSW 3 107472191 missense probably benign 0.19
R8932:Slc6a17 UTSW 3 107472191 missense probably benign 0.19
R9287:Slc6a17 UTSW 3 107477235 missense probably damaging 1.00
R9483:Slc6a17 UTSW 3 107471456 missense possibly damaging 0.50
R9601:Slc6a17 UTSW 3 107473614 missense possibly damaging 0.95
R9617:Slc6a17 UTSW 3 107477369 missense probably damaging 1.00
X0010:Slc6a17 UTSW 3 107493106 missense probably benign 0.05
X0062:Slc6a17 UTSW 3 107500368 missense probably null 1.00
Z1176:Slc6a17 UTSW 3 107476766 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGAACTATGATCTCTTGCCCC -3'
(R):5'- AGCTCAGAACCTCAGCTTCC -3'

Sequencing Primer
(F):5'- TTGCCCCTTTCAAAAGCAGC -3'
(R):5'- CGCTCCGGAAACTACTT -3'
Posted On 2020-07-28