Mutagenetix > Incidental Mutation

Incidental Mutation 'R8305:Col24a1'

640981

Institutional Source

Beutler Lab

Gene Symbol

Col24a1

Ensembl Gene

ENSMUSG00000028197

Gene Name

collagen, type XXIV, alpha 1

Synonyms

5430404K19Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8305 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

145292472-145552011 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 145474182 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1143 (V1143A)

Ref Sequence

ENSEMBL: ENSMUSP00000029848 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029848]

AlphaFold

Q30D77

Predicted Effect

probably benign
Transcript: ENSMUST00000029848
AA Change: V1143A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: V1143A

Domain	Start	End	E-Value	Type
transmembrane domain	21	40	N/A	INTRINSIC
TSPN	41	230	2.7e-3	SMART
LamG	106	229	8.07e-2	SMART
Pfam:Collagen	506	565	9.6e-10	PFAM
Pfam:Collagen	561	623	3.4e-10	PFAM
Pfam:Collagen	604	678	2.3e-9	PFAM
low complexity region	682	724	N/A	INTRINSIC
Pfam:Collagen	772	837	1.3e-10	PFAM
Pfam:Collagen	865	938	6e-9	PFAM
Pfam:Collagen	967	1042	3.1e-8	PFAM
low complexity region	1056	1075	N/A	INTRINSIC
Pfam:Collagen	1107	1180	8e-9	PFAM
Pfam:Collagen	1159	1218	4.2e-10	PFAM
Pfam:Collagen	1218	1279	1.8e-10	PFAM
Pfam:Collagen	1270	1334	3.1e-9	PFAM
Pfam:Collagen	1378	1443	1.3e-9	PFAM
Pfam:Collagen	1439	1500	1.8e-9	PFAM
COLFI	1533	1733	9.34e-34	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578I06Rik	C	T	14: 63,971,395	E243K	possibly damaging	Het
Accsl	A	T	2: 93,866,078	H58Q	probably benign	Het
Actl7a	T	A	4: 56,743,744	F90L	probably benign	Het
Adam5	G	A	8: 24,810,703	A270V	possibly damaging	Het
Angptl3	A	G	4: 99,031,311	T103A	probably damaging	Het
Ankhd1	T	C	18: 36,647,166	L1757P	possibly damaging	Het
Apoa4	T	A	9: 46,241,155	M1K	probably null	Het
Arih1	T	A	9: 59,396,487	Q445L	probably benign	Het
Asb14	A	T	14: 26,912,097	I420L	probably benign	Het
Bbs2	A	C	8: 94,074,325	V626G	probably damaging	Het
BC089597	T	A	10: 127,876,995	D287E	probably damaging	Het
Cep290	C	A	10: 100,544,934	A1678D	probably benign	Het
Cilp	G	A	9: 65,279,004	G794S	probably damaging	Het
Clca3a1	C	T	3: 144,759,166		probably benign	Het
Clca3b	T	A	3: 144,825,937	N702I	probably damaging	Het
Cux1	T	C	5: 136,360,009	T223A	probably benign	Het
Defa30	A	T	8: 21,135,459	T80S	probably benign	Het
Dennd1a	G	A	2: 37,858,081	L375F	probably damaging	Het
Dnajc6	C	T	4: 101,623,787	T675I	probably damaging	Het
Emc9	A	G	14: 55,585,099	V4A	probably damaging	Het
Enpp3	C	G	10: 24,824,929		probably null	Het
Fam117b	A	G	1: 59,913,623	T154A	probably benign	Het
Filip1	G	T	9: 79,820,475	Y287*	probably null	Het
Flt3	T	C	5: 147,348,054	D751G	probably damaging	Het
Frem1	T	A	4: 82,999,989	Q572L	probably benign	Het
Gja10	G	A	4: 32,602,441		probably benign	Het
Gm7356	T	A	17: 14,001,437	Y110F	probably benign	Het
Igf2r	T	C	17: 12,733,860	K233R	probably benign	Het
Igkv9-129	A	T	6: 67,840,222	E103D	probably benign	Het
Igsf11	C	A	16: 39,007,224	T48N	probably damaging	Het
Itpkc	A	T	7: 27,214,519	Y506N	probably damaging	Het
Kat2a	A	C	11: 100,709,478	M357R	possibly damaging	Het
Kbtbd12	T	C	6: 88,618,150	R233G	possibly damaging	Het
Kcnd2	T	A	6: 21,726,198	C563*	probably null	Het
Kcnu1	T	C	8: 25,891,990	V456A	probably benign	Het
Kif24	A	G	4: 41,428,825	V45A	probably damaging	Het
Macf1	A	T	4: 123,395,621		probably benign	Het
Map3k19	T	A	1: 127,817,270	E1177D		Het
Mdn1	G	T	4: 32,725,107	L2575F	probably benign	Het
Mga	T	A	2: 119,946,319	M1569K	possibly damaging	Het
Mvk	T	C	5: 114,450,779	Y161H	probably damaging	Het
Olfr119	T	A	17: 37,701,498	M276K	probably benign	Het
Olfr134	C	A	17: 38,175,573	T163K	probably damaging	Het
Olfr301	G	T	7: 86,412,779	C139F	probably damaging	Het
Pcdhb14	T	A	18: 37,450,022	V727E	possibly damaging	Het
Pcsk7	T	G	9: 45,910,409	V167G	probably damaging	Het
Plin5	T	C	17: 56,115,221	D146G	probably benign	Het
Plxna4	C	T	6: 32,211,065	G879R	possibly damaging	Het
Prss58	C	T	6: 40,895,660	A171T	probably benign	Het
Pum1	A	G	4: 130,771,920	I1016V	probably benign	Het
Rbm43	A	G	2: 51,926,700	V85A	probably damaging	Het
RP23-56A14.9	A	G	7: 142,135,623	C138R	unknown	Het
Rptor	T	A	11: 119,811,986	L393Q	probably damaging	Het
Sbf2	T	G	7: 110,371,618	H857P	possibly damaging	Het
Scn8a	A	C	15: 101,040,506	T1919P	probably benign	Het
Sema6b	C	T	17: 56,127,084	G377E	probably damaging	Het
Senp7	T	A	16: 56,155,240	D436E	probably damaging	Het
Slc6a17	T	A	3: 107,473,585	I535F	probably benign	Het
Sptbn2	T	A	19: 4,729,130	S281T	possibly damaging	Het
Stt3b	T	C	9: 115,254,931	I392M	probably damaging	Het
Tfap2b	T	C	1: 19,226,436	V201A	possibly damaging	Het
Timm10b	T	C	7: 105,640,669		probably benign	Het
Ttc23	A	C	7: 67,662,387	D14A	probably damaging	Het
Usp32	A	T	11: 85,032,185	L636I	possibly damaging	Het
Vgll4	G	T	6: 114,890,652	H79Q	probably damaging	Het
Vps13d	A	G	4: 145,092,288	I3047T		Het
Zan	T	C	5: 137,450,551	E1680G	unknown	Het

Other mutations in Col24a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Col24a1	APN	3	145362309	missense	probably damaging	1.00
IGL00931:Col24a1	APN	3	145461470	missense	probably benign	0.00
IGL01160:Col24a1	APN	3	145507713	missense	probably damaging	1.00
IGL01355:Col24a1	APN	3	145314876	missense	probably benign	0.07
IGL01409:Col24a1	APN	3	145538564	missense	probably benign	0.19
IGL01587:Col24a1	APN	3	145433355	splice site	probably null
IGL01666:Col24a1	APN	3	145344686	missense	possibly damaging	0.93
IGL01717:Col24a1	APN	3	145524263	splice site	probably benign
IGL01721:Col24a1	APN	3	145538567	missense	probably benign	0.26
IGL01939:Col24a1	APN	3	145315244	missense	probably damaging	1.00
IGL01988:Col24a1	APN	3	145524167	splice site	probably null
IGL02002:Col24a1	APN	3	145356944	missense	possibly damaging	0.81
IGL02172:Col24a1	APN	3	145314962	missense	probably benign	0.34
IGL02552:Col24a1	APN	3	145474207	missense	possibly damaging	0.88
IGL02559:Col24a1	APN	3	145314173	missense	probably benign
IGL02582:Col24a1	APN	3	145314486	missense	probably damaging	1.00
IGL02652:Col24a1	APN	3	145492301	nonsense	probably null
IGL02942:Col24a1	APN	3	145541665	missense	probably damaging	1.00
IGL03032:Col24a1	APN	3	145538703	critical splice donor site	probably null
IGL03108:Col24a1	APN	3	145323401	missense	probably damaging	1.00
IGL03310:Col24a1	APN	3	145313983	splice site	probably benign
IGL03405:Col24a1	APN	3	145315157	missense	possibly damaging	0.73
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0379:Col24a1	UTSW	3	145524142	missense	possibly damaging	0.94
R0502:Col24a1	UTSW	3	145545316	splice site	probably benign
R0556:Col24a1	UTSW	3	145314728	missense	possibly damaging	0.53
R0587:Col24a1	UTSW	3	145293145	missense	possibly damaging	0.50
R0617:Col24a1	UTSW	3	145314120	missense	probably damaging	1.00
R0831:Col24a1	UTSW	3	145328759	missense	probably damaging	1.00
R1455:Col24a1	UTSW	3	145460838	missense	probably damaging	1.00
R1664:Col24a1	UTSW	3	145389600	critical splice donor site	probably null
R1713:Col24a1	UTSW	3	145366869	nonsense	probably null
R1854:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1855:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1861:Col24a1	UTSW	3	145537267	critical splice donor site	probably null
R1969:Col24a1	UTSW	3	145314930	missense	probably benign	0.03
R2216:Col24a1	UTSW	3	145314981	missense	probably benign	0.34
R2290:Col24a1	UTSW	3	145513195	missense	probably damaging	1.00
R3702:Col24a1	UTSW	3	145337860	missense	probably benign	0.01
R3772:Col24a1	UTSW	3	145545286	missense	probably damaging	1.00
R4086:Col24a1	UTSW	3	145461437	missense	probably damaging	1.00
R4236:Col24a1	UTSW	3	145524282	nonsense	probably null
R4433:Col24a1	UTSW	3	145314383	missense	possibly damaging	0.95
R4688:Col24a1	UTSW	3	145314383	missense	probably benign	0.00
R4972:Col24a1	UTSW	3	145509684	missense	probably benign	0.42
R5157:Col24a1	UTSW	3	145345951	nonsense	probably null
R5216:Col24a1	UTSW	3	145315310	missense	possibly damaging	0.85
R5274:Col24a1	UTSW	3	145484678	missense	probably benign	0.03
R5334:Col24a1	UTSW	3	145461525	missense	possibly damaging	0.91
R5416:Col24a1	UTSW	3	145315025	nonsense	probably null
R5473:Col24a1	UTSW	3	145537261	missense	probably benign	0.41
R5538:Col24a1	UTSW	3	145293121	missense	probably damaging	0.99
R5561:Col24a1	UTSW	3	145298827	missense	probably benign	0.26
R5648:Col24a1	UTSW	3	145358566	missense	probably benign	0.00
R5920:Col24a1	UTSW	3	145428230	missense	probably damaging	1.00
R6111:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6151:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6701:Col24a1	UTSW	3	145314380	missense	probably benign	0.00
R6728:Col24a1	UTSW	3	145315196	missense	probably benign
R6734:Col24a1	UTSW	3	145508674	missense	probably benign	0.06
R6861:Col24a1	UTSW	3	145460834	missense	probably damaging	1.00
R6982:Col24a1	UTSW	3	145315046	nonsense	probably null
R7001:Col24a1	UTSW	3	145298866	missense	probably benign	0.28
R7148:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R7293:Col24a1	UTSW	3	145486304	nonsense	probably null
R7315:Col24a1	UTSW	3	145431870	missense	possibly damaging	0.82
R7358:Col24a1	UTSW	3	145293165	critical splice donor site	probably null
R7371:Col24a1	UTSW	3	145343698	missense	probably benign	0.06
R7383:Col24a1	UTSW	3	145298838	missense	probably benign
R7605:Col24a1	UTSW	3	145538687	missense	possibly damaging	0.67
R7650:Col24a1	UTSW	3	145314453	missense	probably benign	0.00
R7679:Col24a1	UTSW	3	145399355	missense	possibly damaging	0.81
R7701:Col24a1	UTSW	3	145315011	missense	probably benign
R7701:Col24a1	UTSW	3	145366901	splice site	probably null
R7805:Col24a1	UTSW	3	145314140	missense	probably benign	0.02
R7913:Col24a1	UTSW	3	145431866	nonsense	probably null
R7921:Col24a1	UTSW	3	145474238	missense	probably damaging	1.00
R8056:Col24a1	UTSW	3	145314164	missense	possibly damaging	0.73
R8240:Col24a1	UTSW	3	145507702	missense	probably benign	0.31
R8294:Col24a1	UTSW	3	145481089	missense	probably null	1.00
R8430:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R8708:Col24a1	UTSW	3	145545265	missense	probably damaging	0.99
R8880:Col24a1	UTSW	3	145314037	missense	probably null
R9056:Col24a1	UTSW	3	145315248	missense	probably damaging	0.96
R9461:Col24a1	UTSW	3	145481124	nonsense	probably null
R9612:Col24a1	UTSW	3	145545205	missense	probably benign	0.32
R9777:Col24a1	UTSW	3	145315342	nonsense	probably null
Z1176:Col24a1	UTSW	3	145342498	missense	probably damaging	1.00
Z1177:Col24a1	UTSW	3	145342499	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCTGTGGTATTGGTAACTTGAAGC -3'
(R):5'- CCTCTGTAAAGTCAATCAAGATGAC -3'

Sequencing Primer
(F):5'- GTGTGATAGCATACACCTGTAATCCC -3'
(R):5'- CTCTCTGAGAGCATGCACG -3'

Posted On

2020-07-28