Incidental Mutation 'R8305:Angptl3'
ID 640987
Institutional Source Beutler Lab
Gene Symbol Angptl3
Ensembl Gene ENSMUSG00000028553
Gene Name angiopoietin-like 3
Synonyms hypl
MMRRC Submission 067716-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.213) question?
Stock # R8305 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 98919191-98926429 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98919548 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 103 (T103A)
Ref Sequence ENSEMBL: ENSMUSP00000030280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030280] [ENSMUST00000030286] [ENSMUST00000075836] [ENSMUST00000127417] [ENSMUST00000205650]
AlphaFold Q9R182
Predicted Effect probably damaging
Transcript: ENSMUST00000030280
AA Change: T103A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030280
Gene: ENSMUSG00000028553
AA Change: T103A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
Blast:FBG 195 240 6e-8 BLAST
FBG 241 454 1.5e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030286
SMART Domains Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
Pfam:DUF3398 67 159 6.5e-30 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 557 736 1.8e-51 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1135 1163 N/A INTRINSIC
low complexity region 1350 1364 N/A INTRINSIC
low complexity region 1543 1565 N/A INTRINSIC
Pfam:DHR-2 1571 2095 1.4e-217 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075836
SMART Domains Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
Pfam:DUF3398 65 159 5.8e-34 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 556 737 3.3e-58 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1105 1133 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
low complexity region 1513 1535 N/A INTRINSIC
Pfam:Ded_cyto 1888 2065 6.5e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127417
SMART Domains Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
low complexity region 140 162 N/A INTRINSIC
Pfam:Ded_cyto 517 694 3e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131386
Predicted Effect probably benign
Transcript: ENSMUST00000205650
Meta Mutation Damage Score 0.1000 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: This gene encodes a member of the angiopoietin-like family of proteins. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may inhibit triglyceride metabolism. Homozygous knockout mice for this gene exhibit reduced plasma lipid concentrations, including reduced plasma triglyceride concentrations, and enhanced activity of enzymes involved in triglyceride metabolism. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a disruption in this gene display decreased plasma cholesterol and triglyceride levels. A spontaneous mutation results in a similar phenotype except that there is also a reduction in fat pad weight and decreased free fatty acid levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 64,208,844 (GRCm39) E243K possibly damaging Het
Accsl A T 2: 93,696,423 (GRCm39) H58Q probably benign Het
Actl7a T A 4: 56,743,744 (GRCm39) F90L probably benign Het
Adam5 G A 8: 25,300,719 (GRCm39) A270V possibly damaging Het
Ankhd1 T C 18: 36,780,219 (GRCm39) L1757P possibly damaging Het
Apoa4 T A 9: 46,152,453 (GRCm39) M1K probably null Het
Arih1 T A 9: 59,303,770 (GRCm39) Q445L probably benign Het
Asb14 A T 14: 26,634,054 (GRCm39) I420L probably benign Het
Bbs2 A C 8: 94,800,953 (GRCm39) V626G probably damaging Het
Cep290 C A 10: 100,380,796 (GRCm39) A1678D probably benign Het
Cilp G A 9: 65,186,286 (GRCm39) G794S probably damaging Het
Clca3a1 C T 3: 144,464,927 (GRCm39) probably benign Het
Clca3b T A 3: 144,531,698 (GRCm39) N702I probably damaging Het
Col24a1 T C 3: 145,179,937 (GRCm39) V1143A probably benign Het
Cux1 T C 5: 136,388,863 (GRCm39) T223A probably benign Het
Defa30 A T 8: 21,625,475 (GRCm39) T80S probably benign Het
Dennd1a G A 2: 37,748,093 (GRCm39) L375F probably damaging Het
Dnajc6 C T 4: 101,480,984 (GRCm39) T675I probably damaging Het
Emc9 A G 14: 55,822,556 (GRCm39) V4A probably damaging Het
Enpp3 C G 10: 24,700,827 (GRCm39) probably null Het
Fam117b A G 1: 59,952,782 (GRCm39) T154A probably benign Het
Filip1 G T 9: 79,727,757 (GRCm39) Y287* probably null Het
Flt3 T C 5: 147,284,864 (GRCm39) D751G probably damaging Het
Frem1 T A 4: 82,918,226 (GRCm39) Q572L probably benign Het
Gja10 G A 4: 32,602,441 (GRCm39) probably benign Het
Gm39115 A G 7: 141,689,360 (GRCm39) C138R unknown Het
Gm7356 T A 17: 14,221,699 (GRCm39) Y110F probably benign Het
Igf2r T C 17: 12,952,747 (GRCm39) K233R probably benign Het
Igkv9-129 A T 6: 67,817,206 (GRCm39) E103D probably benign Het
Igsf11 C A 16: 38,827,586 (GRCm39) T48N probably damaging Het
Itpkc A T 7: 26,913,944 (GRCm39) Y506N probably damaging Het
Kat2a A C 11: 100,600,304 (GRCm39) M357R possibly damaging Het
Kbtbd12 T C 6: 88,595,132 (GRCm39) R233G possibly damaging Het
Kcnd2 T A 6: 21,726,197 (GRCm39) C563* probably null Het
Kcnu1 T C 8: 26,382,018 (GRCm39) V456A probably benign Het
Kif24 A G 4: 41,428,825 (GRCm39) V45A probably damaging Het
Macf1 A T 4: 123,289,414 (GRCm39) probably benign Het
Map3k19 T A 1: 127,745,007 (GRCm39) E1177D Het
Mdn1 G T 4: 32,725,107 (GRCm39) L2575F probably benign Het
Mga T A 2: 119,776,800 (GRCm39) M1569K possibly damaging Het
Mvk T C 5: 114,588,840 (GRCm39) Y161H probably damaging Het
Or10al3 T A 17: 38,012,389 (GRCm39) M276K probably benign Het
Or14c44 G T 7: 86,061,987 (GRCm39) C139F probably damaging Het
Or2n1 C A 17: 38,486,464 (GRCm39) T163K probably damaging Het
Pcdhb14 T A 18: 37,583,075 (GRCm39) V727E possibly damaging Het
Pcsk7 T G 9: 45,821,707 (GRCm39) V167G probably damaging Het
Plin5 T C 17: 56,422,221 (GRCm39) D146G probably benign Het
Plxna4 C T 6: 32,188,000 (GRCm39) G879R possibly damaging Het
Prss58 C T 6: 40,872,594 (GRCm39) A171T probably benign Het
Pum1 A G 4: 130,499,231 (GRCm39) I1016V probably benign Het
Rbm43 A G 2: 51,816,712 (GRCm39) V85A probably damaging Het
Rdh16f2 T A 10: 127,712,864 (GRCm39) D287E probably damaging Het
Rptor T A 11: 119,702,812 (GRCm39) L393Q probably damaging Het
Sbf2 T G 7: 109,970,825 (GRCm39) H857P possibly damaging Het
Scn8a A C 15: 100,938,387 (GRCm39) T1919P probably benign Het
Sema6b C T 17: 56,434,084 (GRCm39) G377E probably damaging Het
Senp7 T A 16: 55,975,603 (GRCm39) D436E probably damaging Het
Slc6a17 T A 3: 107,380,901 (GRCm39) I535F probably benign Het
Sptbn2 T A 19: 4,779,158 (GRCm39) S281T possibly damaging Het
Stt3b T C 9: 115,083,999 (GRCm39) I392M probably damaging Het
Tfap2b T C 1: 19,296,660 (GRCm39) V201A possibly damaging Het
Timm10b T C 7: 105,289,876 (GRCm39) probably benign Het
Ttc23 A C 7: 67,312,135 (GRCm39) D14A probably damaging Het
Usp32 A T 11: 84,923,011 (GRCm39) L636I possibly damaging Het
Vgll4 G T 6: 114,867,613 (GRCm39) H79Q probably damaging Het
Vps13d A G 4: 144,818,858 (GRCm39) I3047T Het
Zan T C 5: 137,448,813 (GRCm39) E1680G unknown Het
Other mutations in Angptl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Angptl3 APN 4 98,923,077 (GRCm39) missense probably damaging 0.99
IGL01859:Angptl3 APN 4 98,925,669 (GRCm39) nonsense probably null
IGL02126:Angptl3 APN 4 98,919,738 (GRCm39) critical splice donor site probably null
IGL02134:Angptl3 APN 4 98,919,349 (GRCm39) missense probably damaging 1.00
IGL02573:Angptl3 APN 4 98,926,171 (GRCm39) missense probably damaging 1.00
IGL02756:Angptl3 APN 4 98,919,399 (GRCm39) missense probably damaging 1.00
IGL03369:Angptl3 APN 4 98,923,057 (GRCm39) intron probably benign
R0309:Angptl3 UTSW 4 98,922,706 (GRCm39) missense probably benign 0.32
R0549:Angptl3 UTSW 4 98,919,692 (GRCm39) missense probably benign 0.00
R0675:Angptl3 UTSW 4 98,921,499 (GRCm39) missense probably benign 0.02
R1465:Angptl3 UTSW 4 98,925,757 (GRCm39) missense probably benign 0.01
R1465:Angptl3 UTSW 4 98,925,757 (GRCm39) missense probably benign 0.01
R1738:Angptl3 UTSW 4 98,921,499 (GRCm39) missense probably benign 0.02
R2007:Angptl3 UTSW 4 98,925,634 (GRCm39) missense probably damaging 0.99
R2656:Angptl3 UTSW 4 98,926,201 (GRCm39) missense probably benign 0.01
R3436:Angptl3 UTSW 4 98,921,540 (GRCm39) missense probably benign 0.24
R3437:Angptl3 UTSW 4 98,921,540 (GRCm39) missense probably benign 0.24
R3615:Angptl3 UTSW 4 98,922,702 (GRCm39) missense probably benign 0.06
R3616:Angptl3 UTSW 4 98,922,702 (GRCm39) missense probably benign 0.06
R4161:Angptl3 UTSW 4 98,919,728 (GRCm39) missense probably damaging 0.99
R4534:Angptl3 UTSW 4 98,926,232 (GRCm39) missense possibly damaging 0.73
R4615:Angptl3 UTSW 4 98,919,598 (GRCm39) missense probably benign 0.03
R4835:Angptl3 UTSW 4 98,925,649 (GRCm39) missense probably benign 0.36
R5308:Angptl3 UTSW 4 98,922,723 (GRCm39) missense probably benign 0.33
R5413:Angptl3 UTSW 4 98,919,259 (GRCm39) missense probably benign 0.12
R5668:Angptl3 UTSW 4 98,920,321 (GRCm39) critical splice acceptor site probably null
R5906:Angptl3 UTSW 4 98,925,804 (GRCm39) missense probably benign 0.07
R6520:Angptl3 UTSW 4 98,926,085 (GRCm39) missense probably benign 0.35
R6544:Angptl3 UTSW 4 98,919,675 (GRCm39) missense probably damaging 1.00
R6762:Angptl3 UTSW 4 98,925,654 (GRCm39) missense possibly damaging 0.91
R7889:Angptl3 UTSW 4 98,919,308 (GRCm39) missense probably benign 0.00
R8690:Angptl3 UTSW 4 98,925,759 (GRCm39) missense probably benign 0.00
R9284:Angptl3 UTSW 4 98,919,480 (GRCm39) missense probably benign 0.00
Z1088:Angptl3 UTSW 4 98,922,757 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAAAATTTTAGCGAATGGCCTCC -3'
(R):5'- TGAAAACAATCAGAGTGCTGTG -3'

Sequencing Primer
(F):5'- TTAGCGAATGGCCTCCTGCAG -3'
(R):5'- CAGAGTGCTGTGATTTCTACTTAC -3'
Posted On 2020-07-28