Incidental Mutation 'R8305:Cux1'
ID 640992
Institutional Source Beutler Lab
Gene Symbol Cux1
Ensembl Gene ENSMUSG00000029705
Gene Name cut-like homeobox 1
Synonyms CDP, Cutl1, Cux, Cux-1
MMRRC Submission 067716-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.847) question?
Stock # R8305 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 136276989-136596344 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 136388863 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 223 (T223A)
Ref Sequence ENSEMBL: ENSMUSP00000135086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004097] [ENSMUST00000175918] [ENSMUST00000175975] [ENSMUST00000175998] [ENSMUST00000176172] [ENSMUST00000176216] [ENSMUST00000176423] [ENSMUST00000176745] [ENSMUST00000176778] [ENSMUST00000177297]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000004097
AA Change: T234A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000004097
Gene: ENSMUSG00000029705
AA Change: T234A

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
CUT 452 538 5.06e-39 SMART
low complexity region 602 608 N/A INTRINSIC
low complexity region 620 642 N/A INTRINSIC
CUT 841 929 3.31e-43 SMART
low complexity region 956 972 N/A INTRINSIC
low complexity region 990 1011 N/A INTRINSIC
CUT 1024 1110 3.78e-38 SMART
HOX 1150 1212 6.32e-15 SMART
low complexity region 1224 1239 N/A INTRINSIC
low complexity region 1317 1379 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175918
AA Change: T197A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000135606
Gene: ENSMUSG00000029705
AA Change: T197A

DomainStartEndE-ValueType
coiled coil region 73 328 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175975
AA Change: T234A

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135223
Gene: ENSMUSG00000029705
AA Change: T234A

DomainStartEndE-ValueType
coiled coil region 1 169 N/A INTRINSIC
low complexity region 235 251 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
CUT 358 444 5.06e-39 SMART
low complexity region 508 514 N/A INTRINSIC
low complexity region 526 548 N/A INTRINSIC
CUT 747 835 3.31e-43 SMART
low complexity region 862 878 N/A INTRINSIC
low complexity region 896 917 N/A INTRINSIC
CUT 930 1016 3.78e-38 SMART
HOX 1056 1118 6.32e-15 SMART
low complexity region 1130 1145 N/A INTRINSIC
low complexity region 1223 1285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175998
AA Change: T4A

PolyPhen 2 Score 0.395 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135816
Gene: ENSMUSG00000029705
AA Change: T4A

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
coiled coil region 76 148 N/A INTRINSIC
Pfam:CASP_C 204 430 8.6e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176172
AA Change: T223A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000135086
Gene: ENSMUSG00000029705
AA Change: T223A

DomainStartEndE-ValueType
coiled coil region 99 354 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
low complexity region 462 474 N/A INTRINSIC
low complexity region 516 527 N/A INTRINSIC
CUT 543 629 5.06e-39 SMART
low complexity region 693 699 N/A INTRINSIC
low complexity region 711 733 N/A INTRINSIC
CUT 932 1020 3.31e-43 SMART
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1081 1102 N/A INTRINSIC
CUT 1115 1201 3.78e-38 SMART
HOX 1241 1303 6.32e-15 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1408 1470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176216
AA Change: T234A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000135054
Gene: ENSMUSG00000029705
AA Change: T234A

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 9.35e-5 PROSPERO
Pfam:CASP_C 421 647 1.2e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176423
AA Change: T33A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000135036
Gene: ENSMUSG00000029705
AA Change: T33A

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
coiled coil region 76 148 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176486
AA Change: T96A

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135370
Gene: ENSMUSG00000029705
AA Change: T96A

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 363 N/A INTRINSIC
low complexity region 429 445 N/A INTRINSIC
low complexity region 471 483 N/A INTRINSIC
low complexity region 525 536 N/A INTRINSIC
CUT 552 638 5.06e-39 SMART
Blast:CUT 641 840 3e-50 BLAST
CUT 919 1007 3.31e-43 SMART
low complexity region 1034 1050 N/A INTRINSIC
low complexity region 1068 1089 N/A INTRINSIC
CUT 1102 1188 3.78e-38 SMART
HOX 1228 1290 6.32e-15 SMART
low complexity region 1302 1317 N/A INTRINSIC
low complexity region 1395 1457 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176745
AA Change: T234A

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135512
Gene: ENSMUSG00000029705
AA Change: T234A

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 363 N/A INTRINSIC
internal_repeat_1 367 388 8.95e-5 PROSPERO
Pfam:CASP_C 419 645 1.2e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176778
AA Change: T319A

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000135892
Gene: ENSMUSG00000029705
AA Change: T319A

DomainStartEndE-ValueType
low complexity region 78 86 N/A INTRINSIC
coiled coil region 195 448 N/A INTRINSIC
low complexity region 508 519 N/A INTRINSIC
CUT 535 621 5.06e-39 SMART
low complexity region 685 691 N/A INTRINSIC
low complexity region 703 725 N/A INTRINSIC
CUT 924 1012 3.31e-43 SMART
low complexity region 1039 1055 N/A INTRINSIC
low complexity region 1073 1094 N/A INTRINSIC
CUT 1107 1193 3.78e-38 SMART
HOX 1233 1295 6.32e-15 SMART
low complexity region 1307 1322 N/A INTRINSIC
low complexity region 1400 1462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177297
AA Change: T234A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000134819
Gene: ENSMUSG00000029705
AA Change: T234A

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 8.99e-6 PROSPERO
Pfam:CASP_C 422 527 1.8e-17 PFAM
Meta Mutation Damage Score 0.0565 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (65/66)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed lung development and neonatal mortality. Survivors show growth retardation and hair defects. Homozygotes for a partially deleted protein have curly hair, and females tend to lose their litters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 64,208,844 (GRCm39) E243K possibly damaging Het
Accsl A T 2: 93,696,423 (GRCm39) H58Q probably benign Het
Actl7a T A 4: 56,743,744 (GRCm39) F90L probably benign Het
Adam5 G A 8: 25,300,719 (GRCm39) A270V possibly damaging Het
Angptl3 A G 4: 98,919,548 (GRCm39) T103A probably damaging Het
Ankhd1 T C 18: 36,780,219 (GRCm39) L1757P possibly damaging Het
Apoa4 T A 9: 46,152,453 (GRCm39) M1K probably null Het
Arih1 T A 9: 59,303,770 (GRCm39) Q445L probably benign Het
Asb14 A T 14: 26,634,054 (GRCm39) I420L probably benign Het
Bbs2 A C 8: 94,800,953 (GRCm39) V626G probably damaging Het
Cep290 C A 10: 100,380,796 (GRCm39) A1678D probably benign Het
Cilp G A 9: 65,186,286 (GRCm39) G794S probably damaging Het
Clca3a1 C T 3: 144,464,927 (GRCm39) probably benign Het
Clca3b T A 3: 144,531,698 (GRCm39) N702I probably damaging Het
Col24a1 T C 3: 145,179,937 (GRCm39) V1143A probably benign Het
Defa30 A T 8: 21,625,475 (GRCm39) T80S probably benign Het
Dennd1a G A 2: 37,748,093 (GRCm39) L375F probably damaging Het
Dnajc6 C T 4: 101,480,984 (GRCm39) T675I probably damaging Het
Emc9 A G 14: 55,822,556 (GRCm39) V4A probably damaging Het
Enpp3 C G 10: 24,700,827 (GRCm39) probably null Het
Fam117b A G 1: 59,952,782 (GRCm39) T154A probably benign Het
Filip1 G T 9: 79,727,757 (GRCm39) Y287* probably null Het
Flt3 T C 5: 147,284,864 (GRCm39) D751G probably damaging Het
Frem1 T A 4: 82,918,226 (GRCm39) Q572L probably benign Het
Gja10 G A 4: 32,602,441 (GRCm39) probably benign Het
Gm39115 A G 7: 141,689,360 (GRCm39) C138R unknown Het
Gm7356 T A 17: 14,221,699 (GRCm39) Y110F probably benign Het
Igf2r T C 17: 12,952,747 (GRCm39) K233R probably benign Het
Igkv9-129 A T 6: 67,817,206 (GRCm39) E103D probably benign Het
Igsf11 C A 16: 38,827,586 (GRCm39) T48N probably damaging Het
Itpkc A T 7: 26,913,944 (GRCm39) Y506N probably damaging Het
Kat2a A C 11: 100,600,304 (GRCm39) M357R possibly damaging Het
Kbtbd12 T C 6: 88,595,132 (GRCm39) R233G possibly damaging Het
Kcnd2 T A 6: 21,726,197 (GRCm39) C563* probably null Het
Kcnu1 T C 8: 26,382,018 (GRCm39) V456A probably benign Het
Kif24 A G 4: 41,428,825 (GRCm39) V45A probably damaging Het
Macf1 A T 4: 123,289,414 (GRCm39) probably benign Het
Map3k19 T A 1: 127,745,007 (GRCm39) E1177D Het
Mdn1 G T 4: 32,725,107 (GRCm39) L2575F probably benign Het
Mga T A 2: 119,776,800 (GRCm39) M1569K possibly damaging Het
Mvk T C 5: 114,588,840 (GRCm39) Y161H probably damaging Het
Or10al3 T A 17: 38,012,389 (GRCm39) M276K probably benign Het
Or14c44 G T 7: 86,061,987 (GRCm39) C139F probably damaging Het
Or2n1 C A 17: 38,486,464 (GRCm39) T163K probably damaging Het
Pcdhb14 T A 18: 37,583,075 (GRCm39) V727E possibly damaging Het
Pcsk7 T G 9: 45,821,707 (GRCm39) V167G probably damaging Het
Plin5 T C 17: 56,422,221 (GRCm39) D146G probably benign Het
Plxna4 C T 6: 32,188,000 (GRCm39) G879R possibly damaging Het
Prss58 C T 6: 40,872,594 (GRCm39) A171T probably benign Het
Pum1 A G 4: 130,499,231 (GRCm39) I1016V probably benign Het
Rbm43 A G 2: 51,816,712 (GRCm39) V85A probably damaging Het
Rdh16f2 T A 10: 127,712,864 (GRCm39) D287E probably damaging Het
Rptor T A 11: 119,702,812 (GRCm39) L393Q probably damaging Het
Sbf2 T G 7: 109,970,825 (GRCm39) H857P possibly damaging Het
Scn8a A C 15: 100,938,387 (GRCm39) T1919P probably benign Het
Sema6b C T 17: 56,434,084 (GRCm39) G377E probably damaging Het
Senp7 T A 16: 55,975,603 (GRCm39) D436E probably damaging Het
Slc6a17 T A 3: 107,380,901 (GRCm39) I535F probably benign Het
Sptbn2 T A 19: 4,779,158 (GRCm39) S281T possibly damaging Het
Stt3b T C 9: 115,083,999 (GRCm39) I392M probably damaging Het
Tfap2b T C 1: 19,296,660 (GRCm39) V201A possibly damaging Het
Timm10b T C 7: 105,289,876 (GRCm39) probably benign Het
Ttc23 A C 7: 67,312,135 (GRCm39) D14A probably damaging Het
Usp32 A T 11: 84,923,011 (GRCm39) L636I possibly damaging Het
Vgll4 G T 6: 114,867,613 (GRCm39) H79Q probably damaging Het
Vps13d A G 4: 144,818,858 (GRCm39) I3047T Het
Zan T C 5: 137,448,813 (GRCm39) E1680G unknown Het
Other mutations in Cux1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Cux1 APN 5 136,355,650 (GRCm39) missense probably damaging 1.00
IGL00966:Cux1 APN 5 136,340,345 (GRCm39) intron probably benign
IGL01129:Cux1 APN 5 136,333,572 (GRCm39) intron probably benign
IGL01885:Cux1 APN 5 136,337,301 (GRCm39) missense possibly damaging 0.90
IGL01947:Cux1 APN 5 136,303,979 (GRCm39) missense probably benign 0.04
IGL02259:Cux1 APN 5 136,355,687 (GRCm39) missense probably damaging 1.00
IGL02666:Cux1 APN 5 136,304,169 (GRCm39) nonsense probably null
IGL02826:Cux1 APN 5 136,336,857 (GRCm39) missense probably damaging 1.00
IGL03014:Cux1 UTSW 5 136,594,379 (GRCm39) intron probably benign
R0047:Cux1 UTSW 5 136,392,107 (GRCm39) splice site probably benign
R0047:Cux1 UTSW 5 136,392,107 (GRCm39) splice site probably benign
R0057:Cux1 UTSW 5 136,285,136 (GRCm39) missense probably damaging 1.00
R0149:Cux1 UTSW 5 136,308,351 (GRCm39) missense probably damaging 1.00
R0295:Cux1 UTSW 5 136,342,066 (GRCm39) missense probably benign 0.04
R0361:Cux1 UTSW 5 136,308,351 (GRCm39) missense probably damaging 1.00
R0533:Cux1 UTSW 5 136,336,713 (GRCm39) missense probably damaging 1.00
R0630:Cux1 UTSW 5 136,315,689 (GRCm39) missense probably damaging 1.00
R0801:Cux1 UTSW 5 136,355,783 (GRCm39) missense probably damaging 0.97
R0884:Cux1 UTSW 5 136,336,689 (GRCm39) missense probably damaging 1.00
R0976:Cux1 UTSW 5 136,342,144 (GRCm39) missense probably damaging 1.00
R1073:Cux1 UTSW 5 136,281,395 (GRCm39) critical splice donor site probably null
R1222:Cux1 UTSW 5 136,304,003 (GRCm39) missense probably benign 0.18
R1518:Cux1 UTSW 5 136,337,133 (GRCm39) missense probably benign 0.29
R1686:Cux1 UTSW 5 136,304,235 (GRCm39) nonsense probably null
R1687:Cux1 UTSW 5 136,341,523 (GRCm39) missense probably damaging 1.00
R1758:Cux1 UTSW 5 136,421,176 (GRCm39) missense probably damaging 1.00
R1797:Cux1 UTSW 5 136,304,169 (GRCm39) missense probably benign 0.22
R1919:Cux1 UTSW 5 136,392,173 (GRCm39) nonsense probably null
R2051:Cux1 UTSW 5 136,361,512 (GRCm39) missense probably damaging 1.00
R2339:Cux1 UTSW 5 136,315,862 (GRCm39) missense probably damaging 1.00
R3438:Cux1 UTSW 5 136,340,414 (GRCm39) missense probably damaging 0.97
R3713:Cux1 UTSW 5 136,594,397 (GRCm39) intron probably benign
R3800:Cux1 UTSW 5 136,344,887 (GRCm39) missense probably damaging 1.00
R3964:Cux1 UTSW 5 136,311,796 (GRCm39) missense probably damaging 1.00
R4135:Cux1 UTSW 5 136,336,750 (GRCm39) missense probably damaging 1.00
R4198:Cux1 UTSW 5 136,315,702 (GRCm39) missense probably damaging 1.00
R4467:Cux1 UTSW 5 136,341,576 (GRCm39) missense probably damaging 1.00
R4498:Cux1 UTSW 5 136,341,847 (GRCm39) missense probably damaging 1.00
R4622:Cux1 UTSW 5 136,337,154 (GRCm39) missense probably damaging 0.99
R4623:Cux1 UTSW 5 136,337,154 (GRCm39) missense probably damaging 0.99
R4651:Cux1 UTSW 5 136,596,083 (GRCm39) missense probably damaging 1.00
R4652:Cux1 UTSW 5 136,596,083 (GRCm39) missense probably damaging 1.00
R4658:Cux1 UTSW 5 136,279,448 (GRCm39) missense possibly damaging 0.80
R4665:Cux1 UTSW 5 136,315,653 (GRCm39) missense probably damaging 1.00
R4704:Cux1 UTSW 5 136,278,055 (GRCm39) missense probably benign 0.01
R4867:Cux1 UTSW 5 136,303,815 (GRCm39) intron probably benign
R4965:Cux1 UTSW 5 136,340,410 (GRCm39) missense possibly damaging 0.77
R5090:Cux1 UTSW 5 136,342,054 (GRCm39) missense possibly damaging 0.95
R5155:Cux1 UTSW 5 136,594,295 (GRCm39) intron probably benign
R5226:Cux1 UTSW 5 136,399,027 (GRCm39) missense probably benign 0.01
R5252:Cux1 UTSW 5 136,337,151 (GRCm39) missense probably damaging 0.98
R5266:Cux1 UTSW 5 136,341,548 (GRCm39) missense probably damaging 1.00
R5399:Cux1 UTSW 5 136,281,458 (GRCm39) missense possibly damaging 0.58
R5509:Cux1 UTSW 5 136,304,171 (GRCm39) missense probably benign 0.13
R5609:Cux1 UTSW 5 136,421,174 (GRCm39) missense probably damaging 1.00
R5681:Cux1 UTSW 5 136,337,038 (GRCm39) missense probably damaging 1.00
R5993:Cux1 UTSW 5 136,392,125 (GRCm39) missense probably benign 0.00
R6049:Cux1 UTSW 5 136,361,564 (GRCm39) missense probably damaging 1.00
R6290:Cux1 UTSW 5 136,340,412 (GRCm39) missense probably damaging 0.99
R6310:Cux1 UTSW 5 136,304,018 (GRCm39) missense probably benign 0.10
R6351:Cux1 UTSW 5 136,338,646 (GRCm39) missense probably damaging 1.00
R6531:Cux1 UTSW 5 136,303,973 (GRCm39) missense probably benign 0.03
R6590:Cux1 UTSW 5 136,368,971 (GRCm39) missense probably damaging 0.99
R6663:Cux1 UTSW 5 136,514,701 (GRCm39) missense probably damaging 1.00
R6690:Cux1 UTSW 5 136,368,971 (GRCm39) missense probably damaging 0.99
R6777:Cux1 UTSW 5 136,594,422 (GRCm39) intron probably benign
R6786:Cux1 UTSW 5 136,596,085 (GRCm39) missense probably damaging 1.00
R6817:Cux1 UTSW 5 136,402,027 (GRCm39) splice site probably null
R6989:Cux1 UTSW 5 136,308,502 (GRCm39) nonsense probably null
R7011:Cux1 UTSW 5 136,388,887 (GRCm39) missense probably damaging 1.00
R7167:Cux1 UTSW 5 136,338,895 (GRCm39) splice site probably null
R7699:Cux1 UTSW 5 136,514,593 (GRCm39) critical splice donor site probably null
R7861:Cux1 UTSW 5 136,281,458 (GRCm39) missense possibly damaging 0.58
R7876:Cux1 UTSW 5 136,392,161 (GRCm39) missense probably benign 0.00
R7916:Cux1 UTSW 5 136,311,815 (GRCm39) missense probably damaging 1.00
R8023:Cux1 UTSW 5 136,402,251 (GRCm39) missense probably damaging 0.99
R8154:Cux1 UTSW 5 136,281,434 (GRCm39) missense probably damaging 1.00
R8267:Cux1 UTSW 5 136,311,853 (GRCm39) missense probably damaging 1.00
R8289:Cux1 UTSW 5 136,337,358 (GRCm39) missense probably damaging 0.99
R8319:Cux1 UTSW 5 136,594,251 (GRCm39) missense probably benign 0.02
R8405:Cux1 UTSW 5 136,304,241 (GRCm39) missense possibly damaging 0.83
R8483:Cux1 UTSW 5 136,303,944 (GRCm39) missense possibly damaging 0.83
R8506:Cux1 UTSW 5 136,337,358 (GRCm39) missense probably damaging 0.99
R8671:Cux1 UTSW 5 136,279,454 (GRCm39) missense probably damaging 1.00
R8680:Cux1 UTSW 5 136,336,710 (GRCm39) missense possibly damaging 0.46
R8737:Cux1 UTSW 5 136,311,796 (GRCm39) missense probably damaging 1.00
R8738:Cux1 UTSW 5 136,402,220 (GRCm39) missense probably damaging 1.00
R8793:Cux1 UTSW 5 136,594,539 (GRCm39) missense unknown
R8897:Cux1 UTSW 5 136,315,623 (GRCm39) missense probably damaging 1.00
R8926:Cux1 UTSW 5 136,338,404 (GRCm39) intron probably benign
R8954:Cux1 UTSW 5 136,402,203 (GRCm39) nonsense probably null
R9092:Cux1 UTSW 5 136,514,671 (GRCm39) missense probably damaging 1.00
R9205:Cux1 UTSW 5 136,398,989 (GRCm39) missense probably damaging 1.00
R9550:Cux1 UTSW 5 136,340,387 (GRCm39) missense probably damaging 0.99
R9578:Cux1 UTSW 5 136,282,919 (GRCm39) critical splice donor site probably null
R9682:Cux1 UTSW 5 136,337,116 (GRCm39) missense probably benign
R9701:Cux1 UTSW 5 136,343,169 (GRCm39) missense probably damaging 0.97
R9712:Cux1 UTSW 5 136,338,673 (GRCm39) missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GACAGGAGGTTGAGCATCTC -3'
(R):5'- GCACTTCAGAGAGATGAGGC -3'

Sequencing Primer
(F):5'- GAGGTTGAGCATCTCATAAGCCATC -3'
(R):5'- TTGGGTCTGATAGCACACAC -3'
Posted On 2020-07-28