Incidental Mutation 'R8305:Flt3'
ID 640994
Institutional Source Beutler Lab
Gene Symbol Flt3
Ensembl Gene ENSMUSG00000042817
Gene Name FMS-like tyrosine kinase 3
Synonyms Flt-3, CD135, Flk-2, wmfl, Flk2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8305 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 147330741-147400489 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 147348054 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 751 (D751G)
Ref Sequence ENSEMBL: ENSMUSP00000039041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049324]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000049324
AA Change: D751G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000039041
Gene: ENSMUSG00000042817
AA Change: D751G

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
IG 79 162 1.87e0 SMART
IG 258 346 2.57e0 SMART
internal_repeat_1 380 529 8.53e-14 PROSPERO
TyrKc 611 946 1.7e-140 SMART
Meta Mutation Damage Score 0.1600 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class III receptor tyrosine kinase that regulates hematopoiesis. This receptor is activated by binding of the fms-related tyrosine kinase 3 ligand to the extracellular domain, which induces homodimer formation in the plasma membrane leading to autophosphorylation of the receptor. The activated receptor kinase subsequently phosphorylates and activates multiple cytoplasmic effector molecules in pathways involved in apoptosis, proliferation, and differentiation of hematopoietic cells in bone marrow. Mutations that result in the constitutive activation of this receptor result in acute myeloid leukemia and acute lymphoblastic leukemia. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice functionally null for this gene display abnormal lymphopoiesis. Homozygous ENU mutant mice are sensitive to infection by mouse cytomegalovirus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,971,395 E243K possibly damaging Het
Accsl A T 2: 93,866,078 H58Q probably benign Het
Actl7a T A 4: 56,743,744 F90L probably benign Het
Adam5 G A 8: 24,810,703 A270V possibly damaging Het
Angptl3 A G 4: 99,031,311 T103A probably damaging Het
Ankhd1 T C 18: 36,647,166 L1757P possibly damaging Het
Apoa4 T A 9: 46,241,155 M1K probably null Het
Arih1 T A 9: 59,396,487 Q445L probably benign Het
Asb14 A T 14: 26,912,097 I420L probably benign Het
Bbs2 A C 8: 94,074,325 V626G probably damaging Het
BC089597 T A 10: 127,876,995 D287E probably damaging Het
Cep290 C A 10: 100,544,934 A1678D probably benign Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Clca3a1 C T 3: 144,759,166 probably benign Het
Clca3b T A 3: 144,825,937 N702I probably damaging Het
Col24a1 T C 3: 145,474,182 V1143A probably benign Het
Cux1 T C 5: 136,360,009 T223A probably benign Het
Defa30 A T 8: 21,135,459 T80S probably benign Het
Dennd1a G A 2: 37,858,081 L375F probably damaging Het
Dnajc6 C T 4: 101,623,787 T675I probably damaging Het
Emc9 A G 14: 55,585,099 V4A probably damaging Het
Enpp3 C G 10: 24,824,929 probably null Het
Fam117b A G 1: 59,913,623 T154A probably benign Het
Filip1 G T 9: 79,820,475 Y287* probably null Het
Frem1 T A 4: 82,999,989 Q572L probably benign Het
Gja10 G A 4: 32,602,441 probably benign Het
Gm7356 T A 17: 14,001,437 Y110F probably benign Het
Igf2r T C 17: 12,733,860 K233R probably benign Het
Igkv9-129 A T 6: 67,840,222 E103D probably benign Het
Igsf11 C A 16: 39,007,224 T48N probably damaging Het
Itpkc A T 7: 27,214,519 Y506N probably damaging Het
Kat2a A C 11: 100,709,478 M357R possibly damaging Het
Kbtbd12 T C 6: 88,618,150 R233G possibly damaging Het
Kcnd2 T A 6: 21,726,198 C563* probably null Het
Kcnu1 T C 8: 25,891,990 V456A probably benign Het
Kif24 A G 4: 41,428,825 V45A probably damaging Het
Macf1 A T 4: 123,395,621 probably benign Het
Map3k19 T A 1: 127,817,270 E1177D Het
Mdn1 G T 4: 32,725,107 L2575F probably benign Het
Mga T A 2: 119,946,319 M1569K possibly damaging Het
Mvk T C 5: 114,450,779 Y161H probably damaging Het
Olfr119 T A 17: 37,701,498 M276K probably benign Het
Olfr134 C A 17: 38,175,573 T163K probably damaging Het
Olfr301 G T 7: 86,412,779 C139F probably damaging Het
Pcdhb14 T A 18: 37,450,022 V727E possibly damaging Het
Pcsk7 T G 9: 45,910,409 V167G probably damaging Het
Plin5 T C 17: 56,115,221 D146G probably benign Het
Plxna4 C T 6: 32,211,065 G879R possibly damaging Het
Prss58 C T 6: 40,895,660 A171T probably benign Het
Pum1 A G 4: 130,771,920 I1016V probably benign Het
Rbm43 A G 2: 51,926,700 V85A probably damaging Het
RP23-56A14.9 A G 7: 142,135,623 C138R unknown Het
Rptor T A 11: 119,811,986 L393Q probably damaging Het
Sbf2 T G 7: 110,371,618 H857P possibly damaging Het
Scn8a A C 15: 101,040,506 T1919P probably benign Het
Sema6b C T 17: 56,127,084 G377E probably damaging Het
Senp7 T A 16: 56,155,240 D436E probably damaging Het
Slc6a17 T A 3: 107,473,585 I535F probably benign Het
Sptbn2 T A 19: 4,729,130 S281T possibly damaging Het
Stt3b T C 9: 115,254,931 I392M probably damaging Het
Tfap2b T C 1: 19,226,436 V201A possibly damaging Het
Timm10b T C 7: 105,640,669 probably benign Het
Ttc23 A C 7: 67,662,387 D14A probably damaging Het
Usp32 A T 11: 85,032,185 L636I possibly damaging Het
Vgll4 G T 6: 114,890,652 H79Q probably damaging Het
Vps13d A G 4: 145,092,288 I3047T Het
Zan T C 5: 137,450,551 E1680G unknown Het
Other mutations in Flt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Flt3 APN 5 147354876 missense probably damaging 1.00
IGL01083:Flt3 APN 5 147354870 missense probably damaging 1.00
IGL01749:Flt3 APN 5 147358028 missense probably benign 0.02
IGL01765:Flt3 APN 5 147357978 missense probably benign
IGL02109:Flt3 APN 5 147350681 missense probably benign 0.00
IGL02490:Flt3 APN 5 147331296 missense probably damaging 1.00
IGL02631:Flt3 APN 5 147344552 missense probably damaging 1.00
IGL03117:Flt3 APN 5 147356210 missense probably benign
flick UTSW 5 147341238 missense probably damaging 1.00
warmflash UTSW 5 147366918 critical splice donor site probably null
R0070:Flt3 UTSW 5 147372726 splice site probably benign
R0070:Flt3 UTSW 5 147372726 splice site probably benign
R0320:Flt3 UTSW 5 147369579 splice site probably benign
R0347:Flt3 UTSW 5 147357992 missense probably damaging 1.00
R0512:Flt3 UTSW 5 147341270 nonsense probably null
R0968:Flt3 UTSW 5 147341227 missense possibly damaging 0.46
R1180:Flt3 UTSW 5 147341238 missense probably damaging 1.00
R1266:Flt3 UTSW 5 147356860 missense probably benign 0.00
R1562:Flt3 UTSW 5 147344513 missense probably damaging 1.00
R1803:Flt3 UTSW 5 147367055 nonsense probably null
R2000:Flt3 UTSW 5 147341238 missense probably damaging 1.00
R2021:Flt3 UTSW 5 147369490 missense probably damaging 0.98
R2079:Flt3 UTSW 5 147355083 missense probably damaging 0.97
R2261:Flt3 UTSW 5 147348063 missense probably benign 0.00
R2263:Flt3 UTSW 5 147348063 missense probably benign 0.00
R3087:Flt3 UTSW 5 147348046 missense probably benign 0.15
R3727:Flt3 UTSW 5 147354923 missense probably damaging 0.96
R3939:Flt3 UTSW 5 147356243 missense possibly damaging 0.87
R4469:Flt3 UTSW 5 147375644 splice site silent
R4527:Flt3 UTSW 5 147356353 missense probably benign 0.37
R4592:Flt3 UTSW 5 147354699 missense possibly damaging 0.67
R4655:Flt3 UTSW 5 147349593 missense possibly damaging 0.51
R4686:Flt3 UTSW 5 147377048 missense probably damaging 1.00
R4867:Flt3 UTSW 5 147334440 missense probably damaging 1.00
R4897:Flt3 UTSW 5 147369300 missense probably damaging 1.00
R4941:Flt3 UTSW 5 147356375 critical splice acceptor site probably null
R5254:Flt3 UTSW 5 147375690 missense possibly damaging 0.60
R5325:Flt3 UTSW 5 147375649 missense probably benign 0.00
R5395:Flt3 UTSW 5 147354823 missense probably damaging 1.00
R5445:Flt3 UTSW 5 147355095 nonsense probably null
R5469:Flt3 UTSW 5 147355083 missense possibly damaging 0.63
R5556:Flt3 UTSW 5 147332997 splice site probably null
R5660:Flt3 UTSW 5 147369481 missense possibly damaging 0.79
R5879:Flt3 UTSW 5 147334909 missense probably damaging 1.00
R5885:Flt3 UTSW 5 147349629 missense probably damaging 1.00
R6554:Flt3 UTSW 5 147375735 missense probably damaging 0.99
R6813:Flt3 UTSW 5 147354843 missense probably damaging 0.97
R7451:Flt3 UTSW 5 147349667 missense probably damaging 1.00
R7469:Flt3 UTSW 5 147331274 missense probably benign 0.18
R7537:Flt3 UTSW 5 147334437 missense probably damaging 1.00
R7605:Flt3 UTSW 5 147349576 missense probably benign 0.01
R7651:Flt3 UTSW 5 147354922 missense probably damaging 1.00
R7842:Flt3 UTSW 5 147334453 missense probably damaging 1.00
R8051:Flt3 UTSW 5 147358955 intron probably benign
R8236:Flt3 UTSW 5 147356860 missense probably benign 0.00
R8337:Flt3 UTSW 5 147332888 critical splice donor site probably null
R8680:Flt3 UTSW 5 147383455 missense probably benign 0.13
R8682:Flt3 UTSW 5 147383455 missense probably benign 0.13
R8697:Flt3 UTSW 5 147358001 missense possibly damaging 0.94
R8824:Flt3 UTSW 5 147334863 missense probably damaging 1.00
R8959:Flt3 UTSW 5 147366964 missense possibly damaging 0.93
R9235:Flt3 UTSW 5 147383392 missense possibly damaging 0.89
R9324:Flt3 UTSW 5 147376980 missense probably benign 0.27
R9544:Flt3 UTSW 5 147354632 missense possibly damaging 0.76
R9570:Flt3 UTSW 5 147372614 missense possibly damaging 0.91
R9622:Flt3 UTSW 5 147367031 missense possibly damaging 0.92
R9668:Flt3 UTSW 5 147356884 missense probably benign 0.13
X0018:Flt3 UTSW 5 147367066 missense possibly damaging 0.54
Z1088:Flt3 UTSW 5 147349564 critical splice donor site probably null
Z1177:Flt3 UTSW 5 147383401 missense probably benign 0.27
Z31818:Flt3 UTSW 5 147366918 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CATGCACACGTGTATGCAC -3'
(R):5'- CAGCTCTTATCCAGGTTGGCTC -3'

Sequencing Primer
(F):5'- TGTATGCACATACACACATACACTC -3'
(R):5'- TTGACAAGCCAGCATCGTG -3'
Posted On 2020-07-28