Incidental Mutation 'R8305:Kcnd2'
ID 640995
Institutional Source Beutler Lab
Gene Symbol Kcnd2
Ensembl Gene ENSMUSG00000060882
Gene Name potassium voltage-gated channel, Shal-related family, member 2
Synonyms Kv4.2
MMRRC Submission 067716-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.101) question?
Stock # R8305 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 21215502-21729804 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 21726197 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 563 (C563*)
Ref Sequence ENSEMBL: ENSMUSP00000080257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081542]
AlphaFold Q9Z0V2
Predicted Effect probably null
Transcript: ENSMUST00000081542
AA Change: C563*
SMART Domains Protein: ENSMUSP00000080257
Gene: ENSMUSG00000060882
AA Change: C563*

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 4.5e-16 PFAM
BTB 41 140 3.42e-14 SMART
Pfam:Ion_trans 184 417 1.4e-44 PFAM
Pfam:Ion_trans_2 330 411 5.5e-15 PFAM
low complexity region 418 437 N/A INTRINSIC
Pfam:DUF3399 445 546 5.5e-44 PFAM
low complexity region 594 608 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member mediates a rapidly inactivating, A-type outward potassium current which is not under the control of the N terminus as it is in Shaker channels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene reduces A-type currents in spinal cord dorsal horn neurons and increases their excitability, resulting in enhanced sensitivity to tactile and thermal stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 64,208,844 (GRCm39) E243K possibly damaging Het
Accsl A T 2: 93,696,423 (GRCm39) H58Q probably benign Het
Actl7a T A 4: 56,743,744 (GRCm39) F90L probably benign Het
Adam5 G A 8: 25,300,719 (GRCm39) A270V possibly damaging Het
Angptl3 A G 4: 98,919,548 (GRCm39) T103A probably damaging Het
Ankhd1 T C 18: 36,780,219 (GRCm39) L1757P possibly damaging Het
Apoa4 T A 9: 46,152,453 (GRCm39) M1K probably null Het
Arih1 T A 9: 59,303,770 (GRCm39) Q445L probably benign Het
Asb14 A T 14: 26,634,054 (GRCm39) I420L probably benign Het
Bbs2 A C 8: 94,800,953 (GRCm39) V626G probably damaging Het
Cep290 C A 10: 100,380,796 (GRCm39) A1678D probably benign Het
Cilp G A 9: 65,186,286 (GRCm39) G794S probably damaging Het
Clca3a1 C T 3: 144,464,927 (GRCm39) probably benign Het
Clca3b T A 3: 144,531,698 (GRCm39) N702I probably damaging Het
Col24a1 T C 3: 145,179,937 (GRCm39) V1143A probably benign Het
Cux1 T C 5: 136,388,863 (GRCm39) T223A probably benign Het
Defa30 A T 8: 21,625,475 (GRCm39) T80S probably benign Het
Dennd1a G A 2: 37,748,093 (GRCm39) L375F probably damaging Het
Dnajc6 C T 4: 101,480,984 (GRCm39) T675I probably damaging Het
Emc9 A G 14: 55,822,556 (GRCm39) V4A probably damaging Het
Enpp3 C G 10: 24,700,827 (GRCm39) probably null Het
Fam117b A G 1: 59,952,782 (GRCm39) T154A probably benign Het
Filip1 G T 9: 79,727,757 (GRCm39) Y287* probably null Het
Flt3 T C 5: 147,284,864 (GRCm39) D751G probably damaging Het
Frem1 T A 4: 82,918,226 (GRCm39) Q572L probably benign Het
Gja10 G A 4: 32,602,441 (GRCm39) probably benign Het
Gm39115 A G 7: 141,689,360 (GRCm39) C138R unknown Het
Gm7356 T A 17: 14,221,699 (GRCm39) Y110F probably benign Het
Igf2r T C 17: 12,952,747 (GRCm39) K233R probably benign Het
Igkv9-129 A T 6: 67,817,206 (GRCm39) E103D probably benign Het
Igsf11 C A 16: 38,827,586 (GRCm39) T48N probably damaging Het
Itpkc A T 7: 26,913,944 (GRCm39) Y506N probably damaging Het
Kat2a A C 11: 100,600,304 (GRCm39) M357R possibly damaging Het
Kbtbd12 T C 6: 88,595,132 (GRCm39) R233G possibly damaging Het
Kcnu1 T C 8: 26,382,018 (GRCm39) V456A probably benign Het
Kif24 A G 4: 41,428,825 (GRCm39) V45A probably damaging Het
Macf1 A T 4: 123,289,414 (GRCm39) probably benign Het
Map3k19 T A 1: 127,745,007 (GRCm39) E1177D Het
Mdn1 G T 4: 32,725,107 (GRCm39) L2575F probably benign Het
Mga T A 2: 119,776,800 (GRCm39) M1569K possibly damaging Het
Mvk T C 5: 114,588,840 (GRCm39) Y161H probably damaging Het
Or10al3 T A 17: 38,012,389 (GRCm39) M276K probably benign Het
Or14c44 G T 7: 86,061,987 (GRCm39) C139F probably damaging Het
Or2n1 C A 17: 38,486,464 (GRCm39) T163K probably damaging Het
Pcdhb14 T A 18: 37,583,075 (GRCm39) V727E possibly damaging Het
Pcsk7 T G 9: 45,821,707 (GRCm39) V167G probably damaging Het
Plin5 T C 17: 56,422,221 (GRCm39) D146G probably benign Het
Plxna4 C T 6: 32,188,000 (GRCm39) G879R possibly damaging Het
Prss58 C T 6: 40,872,594 (GRCm39) A171T probably benign Het
Pum1 A G 4: 130,499,231 (GRCm39) I1016V probably benign Het
Rbm43 A G 2: 51,816,712 (GRCm39) V85A probably damaging Het
Rdh16f2 T A 10: 127,712,864 (GRCm39) D287E probably damaging Het
Rptor T A 11: 119,702,812 (GRCm39) L393Q probably damaging Het
Sbf2 T G 7: 109,970,825 (GRCm39) H857P possibly damaging Het
Scn8a A C 15: 100,938,387 (GRCm39) T1919P probably benign Het
Sema6b C T 17: 56,434,084 (GRCm39) G377E probably damaging Het
Senp7 T A 16: 55,975,603 (GRCm39) D436E probably damaging Het
Slc6a17 T A 3: 107,380,901 (GRCm39) I535F probably benign Het
Sptbn2 T A 19: 4,779,158 (GRCm39) S281T possibly damaging Het
Stt3b T C 9: 115,083,999 (GRCm39) I392M probably damaging Het
Tfap2b T C 1: 19,296,660 (GRCm39) V201A possibly damaging Het
Timm10b T C 7: 105,289,876 (GRCm39) probably benign Het
Ttc23 A C 7: 67,312,135 (GRCm39) D14A probably damaging Het
Usp32 A T 11: 84,923,011 (GRCm39) L636I possibly damaging Het
Vgll4 G T 6: 114,867,613 (GRCm39) H79Q probably damaging Het
Vps13d A G 4: 144,818,858 (GRCm39) I3047T Het
Zan T C 5: 137,448,813 (GRCm39) E1680G unknown Het
Other mutations in Kcnd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Kcnd2 APN 6 21,714,153 (GRCm39) missense possibly damaging 0.90
IGL01124:Kcnd2 APN 6 21,217,216 (GRCm39) missense probably damaging 1.00
IGL01317:Kcnd2 APN 6 21,727,339 (GRCm39) makesense probably null
IGL01534:Kcnd2 APN 6 21,726,144 (GRCm39) missense probably benign
IGL02623:Kcnd2 APN 6 21,726,194 (GRCm39) missense probably benign 0.05
IGL02682:Kcnd2 APN 6 21,216,924 (GRCm39) nonsense probably null
IGL02874:Kcnd2 APN 6 21,216,922 (GRCm39) missense probably damaging 1.00
IGL02982:Kcnd2 APN 6 21,217,148 (GRCm39) missense probably damaging 1.00
IGL02983:Kcnd2 APN 6 21,216,554 (GRCm39) missense probably damaging 1.00
IGL03119:Kcnd2 APN 6 21,216,508 (GRCm39) nonsense probably null
IGL03154:Kcnd2 APN 6 21,216,707 (GRCm39) missense probably damaging 1.00
IGL03174:Kcnd2 APN 6 21,216,515 (GRCm39) missense possibly damaging 0.93
IGL03296:Kcnd2 APN 6 21,714,208 (GRCm39) missense probably damaging 1.00
R0062:Kcnd2 UTSW 6 21,727,225 (GRCm39) missense possibly damaging 0.80
R0062:Kcnd2 UTSW 6 21,727,225 (GRCm39) missense possibly damaging 0.80
R0325:Kcnd2 UTSW 6 21,216,682 (GRCm39) missense probably damaging 0.99
R0771:Kcnd2 UTSW 6 21,216,441 (GRCm39) missense probably damaging 1.00
R0836:Kcnd2 UTSW 6 21,727,328 (GRCm39) missense probably damaging 1.00
R0836:Kcnd2 UTSW 6 21,726,238 (GRCm39) splice site probably benign
R0884:Kcnd2 UTSW 6 21,216,540 (GRCm39) missense probably benign
R1434:Kcnd2 UTSW 6 21,216,356 (GRCm39) missense probably damaging 1.00
R2116:Kcnd2 UTSW 6 21,216,431 (GRCm39) missense probably damaging 1.00
R3863:Kcnd2 UTSW 6 21,217,262 (GRCm39) nonsense probably null
R3939:Kcnd2 UTSW 6 21,217,095 (GRCm39) missense probably damaging 1.00
R4427:Kcnd2 UTSW 6 21,216,896 (GRCm39) missense probably damaging 0.99
R4561:Kcnd2 UTSW 6 21,216,395 (GRCm39) missense probably benign
R4707:Kcnd2 UTSW 6 21,723,211 (GRCm39) missense probably benign
R5523:Kcnd2 UTSW 6 21,723,211 (GRCm39) missense probably benign
R5545:Kcnd2 UTSW 6 21,217,018 (GRCm39) missense probably damaging 1.00
R5926:Kcnd2 UTSW 6 21,217,084 (GRCm39) missense probably damaging 0.99
R6900:Kcnd2 UTSW 6 21,216,587 (GRCm39) missense probably damaging 1.00
R7010:Kcnd2 UTSW 6 21,216,707 (GRCm39) missense probably damaging 1.00
R7028:Kcnd2 UTSW 6 21,216,177 (GRCm39) start gained probably benign
R7183:Kcnd2 UTSW 6 21,216,436 (GRCm39) missense probably damaging 1.00
R7387:Kcnd2 UTSW 6 21,216,777 (GRCm39) missense probably benign 0.28
R7463:Kcnd2 UTSW 6 21,216,497 (GRCm39) missense probably damaging 1.00
R8007:Kcnd2 UTSW 6 21,217,073 (GRCm39) missense probably damaging 0.99
R8465:Kcnd2 UTSW 6 21,216,695 (GRCm39) missense probably damaging 1.00
R9329:Kcnd2 UTSW 6 21,725,981 (GRCm39) missense probably damaging 1.00
R9532:Kcnd2 UTSW 6 21,727,180 (GRCm39) missense probably benign 0.16
R9766:Kcnd2 UTSW 6 21,216,367 (GRCm39) missense probably benign 0.20
X0021:Kcnd2 UTSW 6 21,217,322 (GRCm39) missense probably damaging 0.99
Z1177:Kcnd2 UTSW 6 21,216,415 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTGCCACCGTCAATCGC -3'
(R):5'- ACTTCCCATGGTGCAGGAAG -3'

Sequencing Primer
(F):5'- TCGCCCATCAAGTCACAGTC -3'
(R):5'- AAGTGTACCTGCAGGATTCC -3'
Posted On 2020-07-28