Incidental Mutation 'R8305:Kbtbd12'
ID 640999
Institutional Source Beutler Lab
Gene Symbol Kbtbd12
Ensembl Gene ENSMUSG00000033182
Gene Name kelch repeat and BTB (POZ) domain containing 12
Synonyms Klhdc6, 4933428M03Rik, 4833415F11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R8305 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 88545114-88637950 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88618150 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 233 (R233G)
Ref Sequence ENSEMBL: ENSMUSP00000112581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120933] [ENSMUST00000184664] [ENSMUST00000184878]
AlphaFold Q9D618
Predicted Effect possibly damaging
Transcript: ENSMUST00000120933
AA Change: R233G

PolyPhen 2 Score 0.498 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112581
Gene: ENSMUSG00000033182
AA Change: R233G

DomainStartEndE-ValueType
BTB 29 126 1.39e-23 SMART
BACK 131 233 6.69e-30 SMART
Kelch 384 434 9.15e-3 SMART
Kelch 435 490 4.3e-8 SMART
Kelch 491 550 1.01e-1 SMART
Kelch 551 601 1.92e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184664
SMART Domains Protein: ENSMUSP00000139069
Gene: ENSMUSG00000033182

DomainStartEndE-ValueType
Pfam:BTB 19 77 6.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184878
SMART Domains Protein: ENSMUSP00000139333
Gene: ENSMUSG00000033182

DomainStartEndE-ValueType
Kelch 30 67 9.94e-1 SMART
Kelch 68 127 1.01e-1 SMART
Kelch 128 178 1.92e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,971,395 E243K possibly damaging Het
Accsl A T 2: 93,866,078 H58Q probably benign Het
Actl7a T A 4: 56,743,744 F90L probably benign Het
Adam5 G A 8: 24,810,703 A270V possibly damaging Het
Angptl3 A G 4: 99,031,311 T103A probably damaging Het
Ankhd1 T C 18: 36,647,166 L1757P possibly damaging Het
Apoa4 T A 9: 46,241,155 M1K probably null Het
Arih1 T A 9: 59,396,487 Q445L probably benign Het
Asb14 A T 14: 26,912,097 I420L probably benign Het
Bbs2 A C 8: 94,074,325 V626G probably damaging Het
BC089597 T A 10: 127,876,995 D287E probably damaging Het
Cep290 C A 10: 100,544,934 A1678D probably benign Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Clca3a1 C T 3: 144,759,166 probably benign Het
Clca3b T A 3: 144,825,937 N702I probably damaging Het
Col24a1 T C 3: 145,474,182 V1143A probably benign Het
Cux1 T C 5: 136,360,009 T223A probably benign Het
Defa30 A T 8: 21,135,459 T80S probably benign Het
Dennd1a G A 2: 37,858,081 L375F probably damaging Het
Dnajc6 C T 4: 101,623,787 T675I probably damaging Het
Emc9 A G 14: 55,585,099 V4A probably damaging Het
Enpp3 C G 10: 24,824,929 probably null Het
Fam117b A G 1: 59,913,623 T154A probably benign Het
Filip1 G T 9: 79,820,475 Y287* probably null Het
Flt3 T C 5: 147,348,054 D751G probably damaging Het
Frem1 T A 4: 82,999,989 Q572L probably benign Het
Gja10 G A 4: 32,602,441 probably benign Het
Gm7356 T A 17: 14,001,437 Y110F probably benign Het
Igf2r T C 17: 12,733,860 K233R probably benign Het
Igkv9-129 A T 6: 67,840,222 E103D probably benign Het
Igsf11 C A 16: 39,007,224 T48N probably damaging Het
Itpkc A T 7: 27,214,519 Y506N probably damaging Het
Kat2a A C 11: 100,709,478 M357R possibly damaging Het
Kcnd2 T A 6: 21,726,198 C563* probably null Het
Kcnu1 T C 8: 25,891,990 V456A probably benign Het
Kif24 A G 4: 41,428,825 V45A probably damaging Het
Macf1 A T 4: 123,395,621 probably benign Het
Map3k19 T A 1: 127,817,270 E1177D Het
Mdn1 G T 4: 32,725,107 L2575F probably benign Het
Mga T A 2: 119,946,319 M1569K possibly damaging Het
Mvk T C 5: 114,450,779 Y161H probably damaging Het
Olfr119 T A 17: 37,701,498 M276K probably benign Het
Olfr134 C A 17: 38,175,573 T163K probably damaging Het
Olfr301 G T 7: 86,412,779 C139F probably damaging Het
Pcdhb14 T A 18: 37,450,022 V727E possibly damaging Het
Pcsk7 T G 9: 45,910,409 V167G probably damaging Het
Plin5 T C 17: 56,115,221 D146G probably benign Het
Plxna4 C T 6: 32,211,065 G879R possibly damaging Het
Prss58 C T 6: 40,895,660 A171T probably benign Het
Pum1 A G 4: 130,771,920 I1016V probably benign Het
Rbm43 A G 2: 51,926,700 V85A probably damaging Het
RP23-56A14.9 A G 7: 142,135,623 C138R unknown Het
Rptor T A 11: 119,811,986 L393Q probably damaging Het
Sbf2 T G 7: 110,371,618 H857P possibly damaging Het
Scn8a A C 15: 101,040,506 T1919P probably benign Het
Sema6b C T 17: 56,127,084 G377E probably damaging Het
Senp7 T A 16: 56,155,240 D436E probably damaging Het
Slc6a17 T A 3: 107,473,585 I535F probably benign Het
Sptbn2 T A 19: 4,729,130 S281T possibly damaging Het
Stt3b T C 9: 115,254,931 I392M probably damaging Het
Tfap2b T C 1: 19,226,436 V201A possibly damaging Het
Timm10b T C 7: 105,640,669 probably benign Het
Ttc23 A C 7: 67,662,387 D14A probably damaging Het
Usp32 A T 11: 85,032,185 L636I possibly damaging Het
Vgll4 G T 6: 114,890,652 H79Q probably damaging Het
Vps13d A G 4: 145,092,288 I3047T Het
Zan T C 5: 137,450,551 E1680G unknown Het
Other mutations in Kbtbd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01600:Kbtbd12 APN 6 88618558 missense probably benign 0.08
IGL01845:Kbtbd12 APN 6 88613940 missense probably benign 0.16
IGL02447:Kbtbd12 APN 6 88618694 missense probably damaging 1.00
IGL02623:Kbtbd12 APN 6 88618389 missense probably damaging 1.00
IGL02851:Kbtbd12 APN 6 88618329 missense probably benign 0.18
R0334:Kbtbd12 UTSW 6 88617906 missense probably damaging 0.99
R1689:Kbtbd12 UTSW 6 88618585 missense probably damaging 1.00
R1712:Kbtbd12 UTSW 6 88618694 missense probably damaging 1.00
R1777:Kbtbd12 UTSW 6 88618060 missense probably benign 0.00
R2037:Kbtbd12 UTSW 6 88617797 missense probably benign 0.00
R3967:Kbtbd12 UTSW 6 88618506 missense probably benign 0.01
R4660:Kbtbd12 UTSW 6 88617790 missense probably benign 0.44
R4785:Kbtbd12 UTSW 6 88618021 missense probably damaging 1.00
R5224:Kbtbd12 UTSW 6 88617699 intron probably benign
R5568:Kbtbd12 UTSW 6 88618627 missense probably damaging 1.00
R6051:Kbtbd12 UTSW 6 88617948 missense possibly damaging 0.69
R6412:Kbtbd12 UTSW 6 88618656 missense probably damaging 1.00
R6525:Kbtbd12 UTSW 6 88614080 missense probably benign 0.29
R6776:Kbtbd12 UTSW 6 88618266 missense probably damaging 0.97
R7046:Kbtbd12 UTSW 6 88618515 missense possibly damaging 0.89
R7157:Kbtbd12 UTSW 6 88618668 missense probably damaging 1.00
R7224:Kbtbd12 UTSW 6 88613983 nonsense probably null
R7303:Kbtbd12 UTSW 6 88614112 missense unknown
R7650:Kbtbd12 UTSW 6 88618548 missense probably damaging 1.00
R7763:Kbtbd12 UTSW 6 88618197 missense probably benign 0.31
R7982:Kbtbd12 UTSW 6 88618634 missense possibly damaging 0.61
R8103:Kbtbd12 UTSW 6 88618681 missense probably damaging 1.00
R8195:Kbtbd12 UTSW 6 88617931 missense possibly damaging 0.64
R9072:Kbtbd12 UTSW 6 88618440 missense probably damaging 1.00
R9073:Kbtbd12 UTSW 6 88618440 missense probably damaging 1.00
R9438:Kbtbd12 UTSW 6 88614058 nonsense probably null
R9773:Kbtbd12 UTSW 6 88547762 missense probably damaging 1.00
Z1177:Kbtbd12 UTSW 6 88618668 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGGTCTTGTGTGACACAGGG -3'
(R):5'- CAGCTTCTGGCACTTATTAAGTCTG -3'

Sequencing Primer
(F):5'- GGGTCATAACAAAAACTGGCATC -3'
(R):5'- CTGGCACTTATTAAGTCTGATGATC -3'
Posted On 2020-07-28