Incidental Mutation 'R8305:Vgll4'
ID 641000
Institutional Source Beutler Lab
Gene Symbol Vgll4
Ensembl Gene ENSMUSG00000030315
Gene Name vestigial like family member 4
Synonyms VGL-4
MMRRC Submission 067716-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8305 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 114837589-114946955 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 114867613 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 79 (H79Q)
Ref Sequence ENSEMBL: ENSMUSP00000032459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032459] [ENSMUST00000139640] [ENSMUST00000147639]
AlphaFold Q80V24
PDB Structure Crystal structure of the VGLL4-TEAD4 complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000032459
AA Change: H79Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032459
Gene: ENSMUSG00000030315
AA Change: H79Q

DomainStartEndE-ValueType
TDU 203 218 5.27e-4 SMART
TDU 231 246 9.84e-4 SMART
low complexity region 251 264 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139640
AA Change: H73Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118618
Gene: ENSMUSG00000030315
AA Change: H73Q

DomainStartEndE-ValueType
Pfam:VGLL4 4 189 1.1e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147639
AA Change: H73Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123139
Gene: ENSMUSG00000030315
AA Change: H73Q

DomainStartEndE-ValueType
TDU 197 212 5.27e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 64,208,844 (GRCm39) E243K possibly damaging Het
Accsl A T 2: 93,696,423 (GRCm39) H58Q probably benign Het
Actl7a T A 4: 56,743,744 (GRCm39) F90L probably benign Het
Adam5 G A 8: 25,300,719 (GRCm39) A270V possibly damaging Het
Angptl3 A G 4: 98,919,548 (GRCm39) T103A probably damaging Het
Ankhd1 T C 18: 36,780,219 (GRCm39) L1757P possibly damaging Het
Apoa4 T A 9: 46,152,453 (GRCm39) M1K probably null Het
Arih1 T A 9: 59,303,770 (GRCm39) Q445L probably benign Het
Asb14 A T 14: 26,634,054 (GRCm39) I420L probably benign Het
Bbs2 A C 8: 94,800,953 (GRCm39) V626G probably damaging Het
Cep290 C A 10: 100,380,796 (GRCm39) A1678D probably benign Het
Cilp G A 9: 65,186,286 (GRCm39) G794S probably damaging Het
Clca3a1 C T 3: 144,464,927 (GRCm39) probably benign Het
Clca3b T A 3: 144,531,698 (GRCm39) N702I probably damaging Het
Col24a1 T C 3: 145,179,937 (GRCm39) V1143A probably benign Het
Cux1 T C 5: 136,388,863 (GRCm39) T223A probably benign Het
Defa30 A T 8: 21,625,475 (GRCm39) T80S probably benign Het
Dennd1a G A 2: 37,748,093 (GRCm39) L375F probably damaging Het
Dnajc6 C T 4: 101,480,984 (GRCm39) T675I probably damaging Het
Emc9 A G 14: 55,822,556 (GRCm39) V4A probably damaging Het
Enpp3 C G 10: 24,700,827 (GRCm39) probably null Het
Fam117b A G 1: 59,952,782 (GRCm39) T154A probably benign Het
Filip1 G T 9: 79,727,757 (GRCm39) Y287* probably null Het
Flt3 T C 5: 147,284,864 (GRCm39) D751G probably damaging Het
Frem1 T A 4: 82,918,226 (GRCm39) Q572L probably benign Het
Gja10 G A 4: 32,602,441 (GRCm39) probably benign Het
Gm39115 A G 7: 141,689,360 (GRCm39) C138R unknown Het
Gm7356 T A 17: 14,221,699 (GRCm39) Y110F probably benign Het
Igf2r T C 17: 12,952,747 (GRCm39) K233R probably benign Het
Igkv9-129 A T 6: 67,817,206 (GRCm39) E103D probably benign Het
Igsf11 C A 16: 38,827,586 (GRCm39) T48N probably damaging Het
Itpkc A T 7: 26,913,944 (GRCm39) Y506N probably damaging Het
Kat2a A C 11: 100,600,304 (GRCm39) M357R possibly damaging Het
Kbtbd12 T C 6: 88,595,132 (GRCm39) R233G possibly damaging Het
Kcnd2 T A 6: 21,726,197 (GRCm39) C563* probably null Het
Kcnu1 T C 8: 26,382,018 (GRCm39) V456A probably benign Het
Kif24 A G 4: 41,428,825 (GRCm39) V45A probably damaging Het
Macf1 A T 4: 123,289,414 (GRCm39) probably benign Het
Map3k19 T A 1: 127,745,007 (GRCm39) E1177D Het
Mdn1 G T 4: 32,725,107 (GRCm39) L2575F probably benign Het
Mga T A 2: 119,776,800 (GRCm39) M1569K possibly damaging Het
Mvk T C 5: 114,588,840 (GRCm39) Y161H probably damaging Het
Or10al3 T A 17: 38,012,389 (GRCm39) M276K probably benign Het
Or14c44 G T 7: 86,061,987 (GRCm39) C139F probably damaging Het
Or2n1 C A 17: 38,486,464 (GRCm39) T163K probably damaging Het
Pcdhb14 T A 18: 37,583,075 (GRCm39) V727E possibly damaging Het
Pcsk7 T G 9: 45,821,707 (GRCm39) V167G probably damaging Het
Plin5 T C 17: 56,422,221 (GRCm39) D146G probably benign Het
Plxna4 C T 6: 32,188,000 (GRCm39) G879R possibly damaging Het
Prss58 C T 6: 40,872,594 (GRCm39) A171T probably benign Het
Pum1 A G 4: 130,499,231 (GRCm39) I1016V probably benign Het
Rbm43 A G 2: 51,816,712 (GRCm39) V85A probably damaging Het
Rdh16f2 T A 10: 127,712,864 (GRCm39) D287E probably damaging Het
Rptor T A 11: 119,702,812 (GRCm39) L393Q probably damaging Het
Sbf2 T G 7: 109,970,825 (GRCm39) H857P possibly damaging Het
Scn8a A C 15: 100,938,387 (GRCm39) T1919P probably benign Het
Sema6b C T 17: 56,434,084 (GRCm39) G377E probably damaging Het
Senp7 T A 16: 55,975,603 (GRCm39) D436E probably damaging Het
Slc6a17 T A 3: 107,380,901 (GRCm39) I535F probably benign Het
Sptbn2 T A 19: 4,779,158 (GRCm39) S281T possibly damaging Het
Stt3b T C 9: 115,083,999 (GRCm39) I392M probably damaging Het
Tfap2b T C 1: 19,296,660 (GRCm39) V201A possibly damaging Het
Timm10b T C 7: 105,289,876 (GRCm39) probably benign Het
Ttc23 A C 7: 67,312,135 (GRCm39) D14A probably damaging Het
Usp32 A T 11: 84,923,011 (GRCm39) L636I possibly damaging Het
Vps13d A G 4: 144,818,858 (GRCm39) I3047T Het
Zan T C 5: 137,448,813 (GRCm39) E1680G unknown Het
Other mutations in Vgll4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01454:Vgll4 APN 6 114,840,957 (GRCm39) missense probably benign 0.10
IGL02080:Vgll4 APN 6 114,839,759 (GRCm39) missense probably damaging 1.00
IGL02551:Vgll4 APN 6 114,839,254 (GRCm39) missense probably damaging 1.00
R0946:Vgll4 UTSW 6 114,867,769 (GRCm39) critical splice acceptor site probably null
R0946:Vgll4 UTSW 6 114,867,768 (GRCm39) critical splice acceptor site probably null
R1710:Vgll4 UTSW 6 114,934,895 (GRCm39) critical splice donor site probably null
R1815:Vgll4 UTSW 6 114,841,020 (GRCm39) missense probably benign 0.05
R1843:Vgll4 UTSW 6 114,839,756 (GRCm39) missense probably benign 0.22
R1922:Vgll4 UTSW 6 114,898,296 (GRCm39) missense probably benign 0.29
R4407:Vgll4 UTSW 6 114,867,573 (GRCm39) splice site probably null
R5147:Vgll4 UTSW 6 114,867,576 (GRCm39) critical splice donor site probably null
R5714:Vgll4 UTSW 6 114,867,737 (GRCm39) missense possibly damaging 0.70
R6080:Vgll4 UTSW 6 114,898,299 (GRCm39) missense probably benign 0.29
R6954:Vgll4 UTSW 6 114,898,328 (GRCm39) missense probably damaging 1.00
R7445:Vgll4 UTSW 6 114,839,157 (GRCm39) missense unknown
R7500:Vgll4 UTSW 6 114,839,293 (GRCm39) missense probably damaging 1.00
R8207:Vgll4 UTSW 6 114,839,786 (GRCm39) missense probably damaging 1.00
R8252:Vgll4 UTSW 6 114,867,695 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGTCACTAAAGTCAGCTCG -3'
(R):5'- GCCCGACTGCTGATAACATC -3'

Sequencing Primer
(F):5'- GCTCGACACCTTCCTGTCATATAAAC -3'
(R):5'- CCTAATTTTCTTTGCATAGGTGAAGC -3'
Posted On 2020-07-28