Incidental Mutation 'R8305:Ttc23'
ID 641002
Institutional Source Beutler Lab
Gene Symbol Ttc23
Ensembl Gene ENSMUSG00000030555
Gene Name tetratricopeptide repeat domain 23
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R8305 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 67647410-67762912 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 67662387 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 14 (D14A)
Ref Sequence ENSEMBL: ENSMUSP00000032774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032774] [ENSMUST00000107470] [ENSMUST00000107471]
AlphaFold Q8CHY7
Predicted Effect probably damaging
Transcript: ENSMUST00000032774
AA Change: D14A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032774
Gene: ENSMUSG00000030555
AA Change: D14A

DomainStartEndE-ValueType
Blast:TPR 45 78 5e-10 BLAST
SCOP:d1a17__ 50 214 6e-8 SMART
Blast:TPR 87 121 3e-10 BLAST
Blast:TPR 137 170 3e-8 BLAST
Blast:TPR 186 219 1e-6 BLAST
low complexity region 310 323 N/A INTRINSIC
Blast:TPR 398 431 5e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000107470
AA Change: D14A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103094
Gene: ENSMUSG00000030555
AA Change: D14A

DomainStartEndE-ValueType
Blast:TPR 45 78 4e-10 BLAST
Blast:TPR 87 121 2e-10 BLAST
Blast:TPR 137 170 3e-8 BLAST
Pfam:TPR_12 185 257 5.9e-10 PFAM
low complexity region 268 281 N/A INTRINSIC
Blast:TPR 356 389 5e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000107471
AA Change: D14A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103095
Gene: ENSMUSG00000030555
AA Change: D14A

DomainStartEndE-ValueType
Blast:TPR 45 78 4e-10 BLAST
Blast:TPR 87 121 2e-10 BLAST
Blast:TPR 137 170 3e-8 BLAST
Pfam:TPR_12 185 257 5.9e-10 PFAM
low complexity region 268 281 N/A INTRINSIC
Blast:TPR 356 389 5e-8 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,971,395 E243K possibly damaging Het
Accsl A T 2: 93,866,078 H58Q probably benign Het
Actl7a T A 4: 56,743,744 F90L probably benign Het
Adam5 G A 8: 24,810,703 A270V possibly damaging Het
Angptl3 A G 4: 99,031,311 T103A probably damaging Het
Ankhd1 T C 18: 36,647,166 L1757P possibly damaging Het
Apoa4 T A 9: 46,241,155 M1K probably null Het
Arih1 T A 9: 59,396,487 Q445L probably benign Het
Asb14 A T 14: 26,912,097 I420L probably benign Het
Bbs2 A C 8: 94,074,325 V626G probably damaging Het
BC089597 T A 10: 127,876,995 D287E probably damaging Het
Cep290 C A 10: 100,544,934 A1678D probably benign Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Clca3a1 C T 3: 144,759,166 probably benign Het
Clca3b T A 3: 144,825,937 N702I probably damaging Het
Col24a1 T C 3: 145,474,182 V1143A probably benign Het
Cux1 T C 5: 136,360,009 T223A probably benign Het
Defa30 A T 8: 21,135,459 T80S probably benign Het
Dennd1a G A 2: 37,858,081 L375F probably damaging Het
Dnajc6 C T 4: 101,623,787 T675I probably damaging Het
Emc9 A G 14: 55,585,099 V4A probably damaging Het
Enpp3 C G 10: 24,824,929 probably null Het
Fam117b A G 1: 59,913,623 T154A probably benign Het
Filip1 G T 9: 79,820,475 Y287* probably null Het
Flt3 T C 5: 147,348,054 D751G probably damaging Het
Frem1 T A 4: 82,999,989 Q572L probably benign Het
Gja10 G A 4: 32,602,441 probably benign Het
Gm7356 T A 17: 14,001,437 Y110F probably benign Het
Igf2r T C 17: 12,733,860 K233R probably benign Het
Igkv9-129 A T 6: 67,840,222 E103D probably benign Het
Igsf11 C A 16: 39,007,224 T48N probably damaging Het
Itpkc A T 7: 27,214,519 Y506N probably damaging Het
Kat2a A C 11: 100,709,478 M357R possibly damaging Het
Kbtbd12 T C 6: 88,618,150 R233G possibly damaging Het
Kcnd2 T A 6: 21,726,198 C563* probably null Het
Kcnu1 T C 8: 25,891,990 V456A probably benign Het
Kif24 A G 4: 41,428,825 V45A probably damaging Het
Macf1 A T 4: 123,395,621 probably benign Het
Map3k19 T A 1: 127,817,270 E1177D Het
Mdn1 G T 4: 32,725,107 L2575F probably benign Het
Mga T A 2: 119,946,319 M1569K possibly damaging Het
Mvk T C 5: 114,450,779 Y161H probably damaging Het
Olfr119 T A 17: 37,701,498 M276K probably benign Het
Olfr134 C A 17: 38,175,573 T163K probably damaging Het
Olfr301 G T 7: 86,412,779 C139F probably damaging Het
Pcdhb14 T A 18: 37,450,022 V727E possibly damaging Het
Pcsk7 T G 9: 45,910,409 V167G probably damaging Het
Plin5 T C 17: 56,115,221 D146G probably benign Het
Plxna4 C T 6: 32,211,065 G879R possibly damaging Het
Prss58 C T 6: 40,895,660 A171T probably benign Het
Pum1 A G 4: 130,771,920 I1016V probably benign Het
Rbm43 A G 2: 51,926,700 V85A probably damaging Het
RP23-56A14.9 A G 7: 142,135,623 C138R unknown Het
Rptor T A 11: 119,811,986 L393Q probably damaging Het
Sbf2 T G 7: 110,371,618 H857P possibly damaging Het
Scn8a A C 15: 101,040,506 T1919P probably benign Het
Sema6b C T 17: 56,127,084 G377E probably damaging Het
Senp7 T A 16: 56,155,240 D436E probably damaging Het
Slc6a17 T A 3: 107,473,585 I535F probably benign Het
Sptbn2 T A 19: 4,729,130 S281T possibly damaging Het
Stt3b T C 9: 115,254,931 I392M probably damaging Het
Tfap2b T C 1: 19,226,436 V201A possibly damaging Het
Timm10b T C 7: 105,640,669 probably benign Het
Usp32 A T 11: 85,032,185 L636I possibly damaging Het
Vgll4 G T 6: 114,890,652 H79Q probably damaging Het
Vps13d A G 4: 145,092,288 I3047T Het
Zan T C 5: 137,450,551 E1680G unknown Het
Other mutations in Ttc23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02852:Ttc23 APN 7 67667155 unclassified probably benign
IGL03257:Ttc23 APN 7 67711378 missense probably damaging 1.00
IGL03365:Ttc23 APN 7 67662337 utr 5 prime probably benign
IGL03404:Ttc23 APN 7 67678897 missense probably damaging 0.99
F5770:Ttc23 UTSW 7 67709315 splice site probably benign
PIT4445001:Ttc23 UTSW 7 67667213 missense probably damaging 1.00
PIT4791001:Ttc23 UTSW 7 67662387 missense probably damaging 1.00
R0295:Ttc23 UTSW 7 67669852 unclassified probably benign
R0316:Ttc23 UTSW 7 67679073 critical splice donor site probably null
R0336:Ttc23 UTSW 7 67662483 missense probably benign 0.01
R1456:Ttc23 UTSW 7 67667154 unclassified probably benign
R1543:Ttc23 UTSW 7 67678995 missense probably benign 0.01
R1662:Ttc23 UTSW 7 67725321 splice site probably null
R1708:Ttc23 UTSW 7 67667176 missense probably damaging 0.99
R1857:Ttc23 UTSW 7 67679073 critical splice donor site probably null
R2292:Ttc23 UTSW 7 67669787 missense probably benign 0.08
R4471:Ttc23 UTSW 7 67670156 missense probably benign 0.37
R6036:Ttc23 UTSW 7 67711366 missense possibly damaging 0.85
R6036:Ttc23 UTSW 7 67711366 missense possibly damaging 0.85
R6841:Ttc23 UTSW 7 67669728 missense possibly damaging 0.91
R7690:Ttc23 UTSW 7 67670170 missense possibly damaging 0.76
R8837:Ttc23 UTSW 7 67669746 missense probably damaging 1.00
R8902:Ttc23 UTSW 7 67693013 missense
R9052:Ttc23 UTSW 7 67692939 nonsense probably null
R9150:Ttc23 UTSW 7 67726102 missense probably damaging 0.99
RF009:Ttc23 UTSW 7 67726029 missense possibly damaging 0.61
X0021:Ttc23 UTSW 7 67670131 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGAATGCCCCTTTGAAATAAAATG -3'
(R):5'- ATGGCTGCTATGTGACCCAG -3'

Sequencing Primer
(F):5'- CCTAGACGTTAACCTAGACT -3'
(R):5'- ATGGCTGCCATGTGACC -3'
Posted On 2020-07-28