Mutagenetix > Incidental Mutation

Incidental Mutation 'R8305:Sbf2'

641004

Institutional Source

Beutler Lab

Gene Symbol

Sbf2

Ensembl Gene

ENSMUSG00000038371

Gene Name

SET binding factor 2

Synonyms

mMTMH1, 4833411B01Rik, Mtmr13, B430219L04Rik, SBF2

MMRRC Submission

Accession Numbers

Genbank: NM_177324; MGI: 1921831

Is this an essential gene?

Possibly non essential (E-score: 0.383) question?

Stock #

R8305 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110308013-110614922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 110371618 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Proline at position 857 (H857P)

Ref Sequence

ENSEMBL: ENSMUSP00000033058 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033058] [ENSMUST00000164759] [ENSMUST00000166020]

AlphaFold

E9PXF8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000033058
AA Change: H857P

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000033058
Gene: ENSMUSG00000038371
AA Change: H857P

Domain	Start	End	E-Value	Type
uDENN	1	87	2.27e-33	SMART
DENN	116	298	5.68e-75	SMART
dDENN	351	420	2e-20	SMART
Pfam:SBF2	530	752	3.3e-106	PFAM
GRAM	869	955	1.3e-12	SMART
low complexity region	1078	1089	N/A	INTRINSIC
Pfam:Myotub-related	1091	1544	8.3e-86	PFAM
PH	1767	1872	3.05e-18	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164759
AA Change: H857P

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000132072
Gene: ENSMUSG00000038371
AA Change: H857P

Domain	Start	End	E-Value	Type
uDENN	1	87	2.27e-33	SMART
DENN	116	298	5.68e-75	SMART
dDENN	351	420	2e-20	SMART
Pfam:SBF2	528	752	1.6e-107	PFAM
GRAM	869	955	1.3e-12	SMART
Pfam:Myotub-related	1089	1521	1.6e-98	PFAM
PH	1742	1847	3.05e-18	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166020
AA Change: H811P

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000126217
Gene: ENSMUSG00000038371
AA Change: H811P

Domain	Start	End	E-Value	Type
uDENN	1	75	9.26e-1	SMART
DENN	70	252	5.68e-75	SMART
dDENN	305	374	2e-20	SMART
Pfam:SBF2	482	706	1.6e-107	PFAM
GRAM	823	909	1.3e-12	SMART
Pfam:Myotub-related	1043	1500	5.9e-98	PFAM
PH	1721	1826	3.05e-18	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudophosphatase and member of the myotubularin-related protein family. This gene maps within the CMT4B2 candidate region of chromosome 11p15 and mutations in this gene have been associated with Charcot-Marie-Tooth Disease, type 4B2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null alleles display progressive misfolding of myelin sheaths and abnormal nerve electrophysiology. [provided by MGI curators]

Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578I06Rik	C	T	14: 63,971,395	E243K	possibly damaging	Het
Accsl	A	T	2: 93,866,078	H58Q	probably benign	Het
Actl7a	T	A	4: 56,743,744	F90L	probably benign	Het
Adam5	G	A	8: 24,810,703	A270V	possibly damaging	Het
Angptl3	A	G	4: 99,031,311	T103A	probably damaging	Het
Ankhd1	T	C	18: 36,647,166	L1757P	possibly damaging	Het
Apoa4	T	A	9: 46,241,155	M1K	probably null	Het
Arih1	T	A	9: 59,396,487	Q445L	probably benign	Het
Asb14	A	T	14: 26,912,097	I420L	probably benign	Het
Bbs2	A	C	8: 94,074,325	V626G	probably damaging	Het
BC089597	T	A	10: 127,876,995	D287E	probably damaging	Het
Cep290	C	A	10: 100,544,934	A1678D	probably benign	Het
Cilp	G	A	9: 65,279,004	G794S	probably damaging	Het
Clca3a1	C	T	3: 144,759,166		probably benign	Het
Clca3b	T	A	3: 144,825,937	N702I	probably damaging	Het
Col24a1	T	C	3: 145,474,182	V1143A	probably benign	Het
Cux1	T	C	5: 136,360,009	T223A	probably benign	Het
Defa30	A	T	8: 21,135,459	T80S	probably benign	Het
Dennd1a	G	A	2: 37,858,081	L375F	probably damaging	Het
Dnajc6	C	T	4: 101,623,787	T675I	probably damaging	Het
Emc9	A	G	14: 55,585,099	V4A	probably damaging	Het
Enpp3	C	G	10: 24,824,929		probably null	Het
Fam117b	A	G	1: 59,913,623	T154A	probably benign	Het
Filip1	G	T	9: 79,820,475	Y287*	probably null	Het
Flt3	T	C	5: 147,348,054	D751G	probably damaging	Het
Frem1	T	A	4: 82,999,989	Q572L	probably benign	Het
Gja10	G	A	4: 32,602,441		probably benign	Het
Gm7356	T	A	17: 14,001,437	Y110F	probably benign	Het
Igf2r	T	C	17: 12,733,860	K233R	probably benign	Het
Igkv9-129	A	T	6: 67,840,222	E103D	probably benign	Het
Igsf11	C	A	16: 39,007,224	T48N	probably damaging	Het
Itpkc	A	T	7: 27,214,519	Y506N	probably damaging	Het
Kat2a	A	C	11: 100,709,478	M357R	possibly damaging	Het
Kbtbd12	T	C	6: 88,618,150	R233G	possibly damaging	Het
Kcnd2	T	A	6: 21,726,198	C563*	probably null	Het
Kcnu1	T	C	8: 25,891,990	V456A	probably benign	Het
Kif24	A	G	4: 41,428,825	V45A	probably damaging	Het
Macf1	A	T	4: 123,395,621		probably benign	Het
Map3k19	T	A	1: 127,817,270	E1177D		Het
Mdn1	G	T	4: 32,725,107	L2575F	probably benign	Het
Mga	T	A	2: 119,946,319	M1569K	possibly damaging	Het
Mvk	T	C	5: 114,450,779	Y161H	probably damaging	Het
Olfr119	T	A	17: 37,701,498	M276K	probably benign	Het
Olfr134	C	A	17: 38,175,573	T163K	probably damaging	Het
Olfr301	G	T	7: 86,412,779	C139F	probably damaging	Het
Pcdhb14	T	A	18: 37,450,022	V727E	possibly damaging	Het
Pcsk7	T	G	9: 45,910,409	V167G	probably damaging	Het
Plin5	T	C	17: 56,115,221	D146G	probably benign	Het
Plxna4	C	T	6: 32,211,065	G879R	possibly damaging	Het
Prss58	C	T	6: 40,895,660	A171T	probably benign	Het
Pum1	A	G	4: 130,771,920	I1016V	probably benign	Het
Rbm43	A	G	2: 51,926,700	V85A	probably damaging	Het
RP23-56A14.9	A	G	7: 142,135,623	C138R	unknown	Het
Rptor	T	A	11: 119,811,986	L393Q	probably damaging	Het
Scn8a	A	C	15: 101,040,506	T1919P	probably benign	Het
Sema6b	C	T	17: 56,127,084	G377E	probably damaging	Het
Senp7	T	A	16: 56,155,240	D436E	probably damaging	Het
Slc6a17	T	A	3: 107,473,585	I535F	probably benign	Het
Sptbn2	T	A	19: 4,729,130	S281T	possibly damaging	Het
Stt3b	T	C	9: 115,254,931	I392M	probably damaging	Het
Tfap2b	T	C	1: 19,226,436	V201A	possibly damaging	Het
Timm10b	T	C	7: 105,640,669		probably benign	Het
Ttc23	A	C	7: 67,662,387	D14A	probably damaging	Het
Usp32	A	T	11: 85,032,185	L636I	possibly damaging	Het
Vgll4	G	T	6: 114,890,652	H79Q	probably damaging	Het
Vps13d	A	G	4: 145,092,288	I3047T		Het
Zan	T	C	5: 137,450,551	E1680G	unknown	Het

Other mutations in Sbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Sbf2	APN	7	110375832	splice site	probably benign
IGL01089:Sbf2	APN	7	110348962	missense	probably damaging	1.00
IGL01144:Sbf2	APN	7	110329903	missense	probably damaging	1.00
IGL01652:Sbf2	APN	7	110447120	missense	probably damaging	1.00
IGL01950:Sbf2	APN	7	110365825	missense	probably benign	0.00
IGL02027:Sbf2	APN	7	110461141	missense	probably damaging	1.00
IGL02244:Sbf2	APN	7	110560295	missense	probably damaging	1.00
IGL02376:Sbf2	APN	7	110462956	missense	probably damaging	0.99
IGL03405:Sbf2	APN	7	110462932	missense	probably damaging	0.98
N/A - 535:Sbf2	UTSW	7	110312752	missense	probably benign
R0084:Sbf2	UTSW	7	110442366	missense	possibly damaging	0.95
R0092:Sbf2	UTSW	7	110320806	splice site	probably benign
R0121:Sbf2	UTSW	7	110489219	critical splice donor site	probably null
R0464:Sbf2	UTSW	7	110464576	splice site	probably benign
R0505:Sbf2	UTSW	7	110399343	missense	probably damaging	1.00
R0531:Sbf2	UTSW	7	110367323	splice site	probably benign
R0554:Sbf2	UTSW	7	110428287	missense	probably damaging	1.00
R0617:Sbf2	UTSW	7	110330683	frame shift	probably null
R0619:Sbf2	UTSW	7	110310262	missense	possibly damaging	0.87
R0799:Sbf2	UTSW	7	110341355	missense	possibly damaging	0.58
R0898:Sbf2	UTSW	7	110371652	missense	possibly damaging	0.59
R1077:Sbf2	UTSW	7	110367172	splice site	probably benign
R1167:Sbf2	UTSW	7	110364549	missense	probably damaging	1.00
R1169:Sbf2	UTSW	7	110310184	missense	probably benign	0.04
R1424:Sbf2	UTSW	7	110315026	missense	probably damaging	1.00
R1536:Sbf2	UTSW	7	110378043	missense	probably damaging	1.00
R1558:Sbf2	UTSW	7	110428346	missense	probably damaging	1.00
R1601:Sbf2	UTSW	7	110340076	critical splice acceptor site	probably null
R1762:Sbf2	UTSW	7	110312758	missense	probably benign
R1771:Sbf2	UTSW	7	110461146	nonsense	probably null
R1989:Sbf2	UTSW	7	110348923	missense	possibly damaging	0.94
R2109:Sbf2	UTSW	7	110461212	missense	probably damaging	1.00
R2126:Sbf2	UTSW	7	110560295	missense	probably damaging	1.00
R2444:Sbf2	UTSW	7	110330698	missense	probably benign	0.31
R3765:Sbf2	UTSW	7	110375581	missense	probably damaging	1.00
R3808:Sbf2	UTSW	7	110489280	makesense	probably null
R3895:Sbf2	UTSW	7	110447091	missense	probably damaging	0.99
R3978:Sbf2	UTSW	7	110329885	missense	probably benign	0.00
R4056:Sbf2	UTSW	7	110441466	missense	probably damaging	0.99
R4057:Sbf2	UTSW	7	110441466	missense	probably damaging	0.99
R4111:Sbf2	UTSW	7	110428242	missense	probably damaging	1.00
R4569:Sbf2	UTSW	7	110348853	critical splice donor site	probably null
R4670:Sbf2	UTSW	7	110335399	missense	probably damaging	1.00
R4763:Sbf2	UTSW	7	110420917	missense	probably damaging	1.00
R4792:Sbf2	UTSW	7	110351610	missense	probably damaging	0.98
R4811:Sbf2	UTSW	7	110372535	missense	probably damaging	1.00
R4822:Sbf2	UTSW	7	110377939	intron	probably benign
R5110:Sbf2	UTSW	7	110364657	missense	probably benign	0.10
R5143:Sbf2	UTSW	7	110422540	nonsense	probably null
R5443:Sbf2	UTSW	7	110377928	intron	probably benign
R5457:Sbf2	UTSW	7	110312830	missense	probably benign
R5641:Sbf2	UTSW	7	110438901	missense	probably damaging	1.00
R5915:Sbf2	UTSW	7	110378096	nonsense	probably null
R5948:Sbf2	UTSW	7	110489285	missense	probably damaging	1.00
R5977:Sbf2	UTSW	7	110377986	missense	probably benign	0.00
R6052:Sbf2	UTSW	7	110441534	missense	probably damaging	1.00
R6142:Sbf2	UTSW	7	110348975	missense	probably damaging	1.00
R6327:Sbf2	UTSW	7	110441552	missense	probably damaging	1.00
R6356:Sbf2	UTSW	7	110372623	missense	probably damaging	1.00
R6450:Sbf2	UTSW	7	110462863	missense	probably damaging	1.00
R6587:Sbf2	UTSW	7	110440975	missense	probably damaging	1.00
R6696:Sbf2	UTSW	7	110560298	missense	probably benign	0.04
R6986:Sbf2	UTSW	7	110330615	missense	probably damaging	0.99
R7147:Sbf2	UTSW	7	110447061	missense	probably benign	0.01
R7358:Sbf2	UTSW	7	110399348	missense	possibly damaging	0.95
R7414:Sbf2	UTSW	7	110314064	missense	possibly damaging	0.89
R7418:Sbf2	UTSW	7	110365821	missense	probably damaging	1.00
R7423:Sbf2	UTSW	7	110438848	missense	possibly damaging	0.48
R7425:Sbf2	UTSW	7	110375777	nonsense	probably null
R7431:Sbf2	UTSW	7	110351750	missense	probably damaging	1.00
R7497:Sbf2	UTSW	7	110614716	nonsense	probably null
R7556:Sbf2	UTSW	7	110314053	missense	probably benign	0.20
R7604:Sbf2	UTSW	7	110378067	missense	possibly damaging	0.95
R7707:Sbf2	UTSW	7	110330713	critical splice acceptor site	probably null
R7746:Sbf2	UTSW	7	110441426	missense	probably benign	0.01
R7812:Sbf2	UTSW	7	110449963	missense	possibly damaging	0.84
R7849:Sbf2	UTSW	7	110372510	missense	probably damaging	1.00
R8026:Sbf2	UTSW	7	110335387	missense	probably damaging	1.00
R8048:Sbf2	UTSW	7	110315082	missense	probably benign	0.21
R8337:Sbf2	UTSW	7	110441462	missense	probably benign
R8773:Sbf2	UTSW	7	110348995	missense	probably benign
R8786:Sbf2	UTSW	7	110464586	critical splice donor site	probably null
R8812:Sbf2	UTSW	7	110329862	missense	probably damaging	1.00
R8876:Sbf2	UTSW	7	110449939	missense	probably damaging	0.99
R8932:Sbf2	UTSW	7	110440948	critical splice donor site	probably null
R8954:Sbf2	UTSW	7	110438911	nonsense	probably null
R8991:Sbf2	UTSW	7	110312689	missense	probably benign	0.20
R9119:Sbf2	UTSW	7	110312085	missense	possibly damaging	0.93
R9310:Sbf2	UTSW	7	110315085	missense	possibly damaging	0.58
R9344:Sbf2	UTSW	7	110341328	missense	probably benign	0.10
R9346:Sbf2	UTSW	7	110320739	missense	probably benign	0.05
R9404:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9406:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9408:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9472:Sbf2	UTSW	7	110371591	missense	possibly damaging	0.88
R9554:Sbf2	UTSW	7	110441464	missense	probably damaging	1.00
R9562:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9624:Sbf2	UTSW	7	110364650	missense	probably damaging	1.00
R9652:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9653:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9709:Sbf2	UTSW	7	110428307	missense	probably damaging	0.99
RF005:Sbf2	UTSW	7	110317008	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCAAATTCCTCAGAACCTTC -3'
(R):5'- TTCACAATGTTCAATCCCTCCAAATAG -3'

Sequencing Primer
(F):5'- ATTCCTCAGAACCTTCCATGAATC -3'
(R):5'- ATGGAAACCTGGGTTTTCCAC -3'

Posted On

2020-07-28