Incidental Mutation 'R8305:Sbf2'
ID 641004
Institutional Source Beutler Lab
Gene Symbol Sbf2
Ensembl Gene ENSMUSG00000038371
Gene Name SET binding factor 2
Synonyms B430219L04Rik, 4833411B01Rik, SBF2, Mtmr13, mMTMH1
MMRRC Submission 067716-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.393) question?
Stock # R8305 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 109907220-110214129 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 109970825 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Proline at position 857 (H857P)
Ref Sequence ENSEMBL: ENSMUSP00000033058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033058] [ENSMUST00000164759] [ENSMUST00000166020]
AlphaFold E9PXF8
Predicted Effect possibly damaging
Transcript: ENSMUST00000033058
AA Change: H857P

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000033058
Gene: ENSMUSG00000038371
AA Change: H857P

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 420 2e-20 SMART
Pfam:SBF2 530 752 3.3e-106 PFAM
GRAM 869 955 1.3e-12 SMART
low complexity region 1078 1089 N/A INTRINSIC
Pfam:Myotub-related 1091 1544 8.3e-86 PFAM
PH 1767 1872 3.05e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000164759
AA Change: H857P

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132072
Gene: ENSMUSG00000038371
AA Change: H857P

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 420 2e-20 SMART
Pfam:SBF2 528 752 1.6e-107 PFAM
GRAM 869 955 1.3e-12 SMART
Pfam:Myotub-related 1089 1521 1.6e-98 PFAM
PH 1742 1847 3.05e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166020
AA Change: H811P

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126217
Gene: ENSMUSG00000038371
AA Change: H811P

DomainStartEndE-ValueType
uDENN 1 75 9.26e-1 SMART
DENN 70 252 5.68e-75 SMART
dDENN 305 374 2e-20 SMART
Pfam:SBF2 482 706 1.6e-107 PFAM
GRAM 823 909 1.3e-12 SMART
Pfam:Myotub-related 1043 1500 5.9e-98 PFAM
PH 1721 1826 3.05e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudophosphatase and member of the myotubularin-related protein family. This gene maps within the CMT4B2 candidate region of chromosome 11p15 and mutations in this gene have been associated with Charcot-Marie-Tooth Disease, type 4B2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null alleles display progressive misfolding of myelin sheaths and abnormal nerve electrophysiology. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 64,208,844 (GRCm39) E243K possibly damaging Het
Accsl A T 2: 93,696,423 (GRCm39) H58Q probably benign Het
Actl7a T A 4: 56,743,744 (GRCm39) F90L probably benign Het
Adam5 G A 8: 25,300,719 (GRCm39) A270V possibly damaging Het
Angptl3 A G 4: 98,919,548 (GRCm39) T103A probably damaging Het
Ankhd1 T C 18: 36,780,219 (GRCm39) L1757P possibly damaging Het
Apoa4 T A 9: 46,152,453 (GRCm39) M1K probably null Het
Arih1 T A 9: 59,303,770 (GRCm39) Q445L probably benign Het
Asb14 A T 14: 26,634,054 (GRCm39) I420L probably benign Het
Bbs2 A C 8: 94,800,953 (GRCm39) V626G probably damaging Het
Cep290 C A 10: 100,380,796 (GRCm39) A1678D probably benign Het
Cilp G A 9: 65,186,286 (GRCm39) G794S probably damaging Het
Clca3a1 C T 3: 144,464,927 (GRCm39) probably benign Het
Clca3b T A 3: 144,531,698 (GRCm39) N702I probably damaging Het
Col24a1 T C 3: 145,179,937 (GRCm39) V1143A probably benign Het
Cux1 T C 5: 136,388,863 (GRCm39) T223A probably benign Het
Defa30 A T 8: 21,625,475 (GRCm39) T80S probably benign Het
Dennd1a G A 2: 37,748,093 (GRCm39) L375F probably damaging Het
Dnajc6 C T 4: 101,480,984 (GRCm39) T675I probably damaging Het
Emc9 A G 14: 55,822,556 (GRCm39) V4A probably damaging Het
Enpp3 C G 10: 24,700,827 (GRCm39) probably null Het
Fam117b A G 1: 59,952,782 (GRCm39) T154A probably benign Het
Filip1 G T 9: 79,727,757 (GRCm39) Y287* probably null Het
Flt3 T C 5: 147,284,864 (GRCm39) D751G probably damaging Het
Frem1 T A 4: 82,918,226 (GRCm39) Q572L probably benign Het
Gja10 G A 4: 32,602,441 (GRCm39) probably benign Het
Gm39115 A G 7: 141,689,360 (GRCm39) C138R unknown Het
Gm7356 T A 17: 14,221,699 (GRCm39) Y110F probably benign Het
Igf2r T C 17: 12,952,747 (GRCm39) K233R probably benign Het
Igkv9-129 A T 6: 67,817,206 (GRCm39) E103D probably benign Het
Igsf11 C A 16: 38,827,586 (GRCm39) T48N probably damaging Het
Itpkc A T 7: 26,913,944 (GRCm39) Y506N probably damaging Het
Kat2a A C 11: 100,600,304 (GRCm39) M357R possibly damaging Het
Kbtbd12 T C 6: 88,595,132 (GRCm39) R233G possibly damaging Het
Kcnd2 T A 6: 21,726,197 (GRCm39) C563* probably null Het
Kcnu1 T C 8: 26,382,018 (GRCm39) V456A probably benign Het
Kif24 A G 4: 41,428,825 (GRCm39) V45A probably damaging Het
Macf1 A T 4: 123,289,414 (GRCm39) probably benign Het
Map3k19 T A 1: 127,745,007 (GRCm39) E1177D Het
Mdn1 G T 4: 32,725,107 (GRCm39) L2575F probably benign Het
Mga T A 2: 119,776,800 (GRCm39) M1569K possibly damaging Het
Mvk T C 5: 114,588,840 (GRCm39) Y161H probably damaging Het
Or10al3 T A 17: 38,012,389 (GRCm39) M276K probably benign Het
Or14c44 G T 7: 86,061,987 (GRCm39) C139F probably damaging Het
Or2n1 C A 17: 38,486,464 (GRCm39) T163K probably damaging Het
Pcdhb14 T A 18: 37,583,075 (GRCm39) V727E possibly damaging Het
Pcsk7 T G 9: 45,821,707 (GRCm39) V167G probably damaging Het
Plin5 T C 17: 56,422,221 (GRCm39) D146G probably benign Het
Plxna4 C T 6: 32,188,000 (GRCm39) G879R possibly damaging Het
Prss58 C T 6: 40,872,594 (GRCm39) A171T probably benign Het
Pum1 A G 4: 130,499,231 (GRCm39) I1016V probably benign Het
Rbm43 A G 2: 51,816,712 (GRCm39) V85A probably damaging Het
Rdh16f2 T A 10: 127,712,864 (GRCm39) D287E probably damaging Het
Rptor T A 11: 119,702,812 (GRCm39) L393Q probably damaging Het
Scn8a A C 15: 100,938,387 (GRCm39) T1919P probably benign Het
Sema6b C T 17: 56,434,084 (GRCm39) G377E probably damaging Het
Senp7 T A 16: 55,975,603 (GRCm39) D436E probably damaging Het
Slc6a17 T A 3: 107,380,901 (GRCm39) I535F probably benign Het
Sptbn2 T A 19: 4,779,158 (GRCm39) S281T possibly damaging Het
Stt3b T C 9: 115,083,999 (GRCm39) I392M probably damaging Het
Tfap2b T C 1: 19,296,660 (GRCm39) V201A possibly damaging Het
Timm10b T C 7: 105,289,876 (GRCm39) probably benign Het
Ttc23 A C 7: 67,312,135 (GRCm39) D14A probably damaging Het
Usp32 A T 11: 84,923,011 (GRCm39) L636I possibly damaging Het
Vgll4 G T 6: 114,867,613 (GRCm39) H79Q probably damaging Het
Vps13d A G 4: 144,818,858 (GRCm39) I3047T Het
Zan T C 5: 137,448,813 (GRCm39) E1680G unknown Het
Other mutations in Sbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Sbf2 APN 7 109,975,039 (GRCm39) splice site probably benign
IGL01089:Sbf2 APN 7 109,948,169 (GRCm39) missense probably damaging 1.00
IGL01144:Sbf2 APN 7 109,929,110 (GRCm39) missense probably damaging 1.00
IGL01652:Sbf2 APN 7 110,046,327 (GRCm39) missense probably damaging 1.00
IGL01950:Sbf2 APN 7 109,965,032 (GRCm39) missense probably benign 0.00
IGL02027:Sbf2 APN 7 110,060,348 (GRCm39) missense probably damaging 1.00
IGL02244:Sbf2 APN 7 110,159,502 (GRCm39) missense probably damaging 1.00
IGL02376:Sbf2 APN 7 110,062,163 (GRCm39) missense probably damaging 0.99
IGL03405:Sbf2 APN 7 110,062,139 (GRCm39) missense probably damaging 0.98
N/A - 535:Sbf2 UTSW 7 109,911,959 (GRCm39) missense probably benign
R0084:Sbf2 UTSW 7 110,041,573 (GRCm39) missense possibly damaging 0.95
R0092:Sbf2 UTSW 7 109,920,013 (GRCm39) splice site probably benign
R0121:Sbf2 UTSW 7 110,088,426 (GRCm39) critical splice donor site probably null
R0464:Sbf2 UTSW 7 110,063,783 (GRCm39) splice site probably benign
R0505:Sbf2 UTSW 7 109,998,550 (GRCm39) missense probably damaging 1.00
R0531:Sbf2 UTSW 7 109,966,530 (GRCm39) splice site probably benign
R0554:Sbf2 UTSW 7 110,027,494 (GRCm39) missense probably damaging 1.00
R0617:Sbf2 UTSW 7 109,929,890 (GRCm39) frame shift probably null
R0619:Sbf2 UTSW 7 109,909,469 (GRCm39) missense possibly damaging 0.87
R0799:Sbf2 UTSW 7 109,940,562 (GRCm39) missense possibly damaging 0.58
R0898:Sbf2 UTSW 7 109,970,859 (GRCm39) missense possibly damaging 0.59
R1077:Sbf2 UTSW 7 109,966,379 (GRCm39) splice site probably benign
R1167:Sbf2 UTSW 7 109,963,756 (GRCm39) missense probably damaging 1.00
R1169:Sbf2 UTSW 7 109,909,391 (GRCm39) missense probably benign 0.04
R1424:Sbf2 UTSW 7 109,914,233 (GRCm39) missense probably damaging 1.00
R1536:Sbf2 UTSW 7 109,977,250 (GRCm39) missense probably damaging 1.00
R1558:Sbf2 UTSW 7 110,027,553 (GRCm39) missense probably damaging 1.00
R1601:Sbf2 UTSW 7 109,939,283 (GRCm39) critical splice acceptor site probably null
R1762:Sbf2 UTSW 7 109,911,965 (GRCm39) missense probably benign
R1771:Sbf2 UTSW 7 110,060,353 (GRCm39) nonsense probably null
R1989:Sbf2 UTSW 7 109,948,130 (GRCm39) missense possibly damaging 0.94
R2109:Sbf2 UTSW 7 110,060,419 (GRCm39) missense probably damaging 1.00
R2126:Sbf2 UTSW 7 110,159,502 (GRCm39) missense probably damaging 1.00
R2444:Sbf2 UTSW 7 109,929,905 (GRCm39) missense probably benign 0.31
R3765:Sbf2 UTSW 7 109,974,788 (GRCm39) missense probably damaging 1.00
R3808:Sbf2 UTSW 7 110,088,487 (GRCm39) makesense probably null
R3895:Sbf2 UTSW 7 110,046,298 (GRCm39) missense probably damaging 0.99
R3978:Sbf2 UTSW 7 109,929,092 (GRCm39) missense probably benign 0.00
R4056:Sbf2 UTSW 7 110,040,673 (GRCm39) missense probably damaging 0.99
R4057:Sbf2 UTSW 7 110,040,673 (GRCm39) missense probably damaging 0.99
R4111:Sbf2 UTSW 7 110,027,449 (GRCm39) missense probably damaging 1.00
R4569:Sbf2 UTSW 7 109,948,060 (GRCm39) critical splice donor site probably null
R4670:Sbf2 UTSW 7 109,934,606 (GRCm39) missense probably damaging 1.00
R4763:Sbf2 UTSW 7 110,020,124 (GRCm39) missense probably damaging 1.00
R4792:Sbf2 UTSW 7 109,950,817 (GRCm39) missense probably damaging 0.98
R4811:Sbf2 UTSW 7 109,971,742 (GRCm39) missense probably damaging 1.00
R4822:Sbf2 UTSW 7 109,977,146 (GRCm39) intron probably benign
R5110:Sbf2 UTSW 7 109,963,864 (GRCm39) missense probably benign 0.10
R5143:Sbf2 UTSW 7 110,021,747 (GRCm39) nonsense probably null
R5443:Sbf2 UTSW 7 109,977,135 (GRCm39) intron probably benign
R5457:Sbf2 UTSW 7 109,912,037 (GRCm39) missense probably benign
R5641:Sbf2 UTSW 7 110,038,108 (GRCm39) missense probably damaging 1.00
R5915:Sbf2 UTSW 7 109,977,303 (GRCm39) nonsense probably null
R5948:Sbf2 UTSW 7 110,088,492 (GRCm39) missense probably damaging 1.00
R5977:Sbf2 UTSW 7 109,977,193 (GRCm39) missense probably benign 0.00
R6052:Sbf2 UTSW 7 110,040,741 (GRCm39) missense probably damaging 1.00
R6142:Sbf2 UTSW 7 109,948,182 (GRCm39) missense probably damaging 1.00
R6327:Sbf2 UTSW 7 110,040,759 (GRCm39) missense probably damaging 1.00
R6356:Sbf2 UTSW 7 109,971,830 (GRCm39) missense probably damaging 1.00
R6450:Sbf2 UTSW 7 110,062,070 (GRCm39) missense probably damaging 1.00
R6587:Sbf2 UTSW 7 110,040,182 (GRCm39) missense probably damaging 1.00
R6696:Sbf2 UTSW 7 110,159,505 (GRCm39) missense probably benign 0.04
R6986:Sbf2 UTSW 7 109,929,822 (GRCm39) missense probably damaging 0.99
R7147:Sbf2 UTSW 7 110,046,268 (GRCm39) missense probably benign 0.01
R7358:Sbf2 UTSW 7 109,998,555 (GRCm39) missense possibly damaging 0.95
R7414:Sbf2 UTSW 7 109,913,271 (GRCm39) missense possibly damaging 0.89
R7418:Sbf2 UTSW 7 109,965,028 (GRCm39) missense probably damaging 1.00
R7423:Sbf2 UTSW 7 110,038,055 (GRCm39) missense possibly damaging 0.48
R7425:Sbf2 UTSW 7 109,974,984 (GRCm39) nonsense probably null
R7431:Sbf2 UTSW 7 109,950,957 (GRCm39) missense probably damaging 1.00
R7497:Sbf2 UTSW 7 110,213,923 (GRCm39) nonsense probably null
R7556:Sbf2 UTSW 7 109,913,260 (GRCm39) missense probably benign 0.20
R7604:Sbf2 UTSW 7 109,977,274 (GRCm39) missense possibly damaging 0.95
R7707:Sbf2 UTSW 7 109,929,920 (GRCm39) critical splice acceptor site probably null
R7746:Sbf2 UTSW 7 110,040,633 (GRCm39) missense probably benign 0.01
R7812:Sbf2 UTSW 7 110,049,170 (GRCm39) missense possibly damaging 0.84
R7849:Sbf2 UTSW 7 109,971,717 (GRCm39) missense probably damaging 1.00
R8026:Sbf2 UTSW 7 109,934,594 (GRCm39) missense probably damaging 1.00
R8048:Sbf2 UTSW 7 109,914,289 (GRCm39) missense probably benign 0.21
R8337:Sbf2 UTSW 7 110,040,669 (GRCm39) missense probably benign
R8773:Sbf2 UTSW 7 109,948,202 (GRCm39) missense probably benign
R8786:Sbf2 UTSW 7 110,063,793 (GRCm39) critical splice donor site probably null
R8812:Sbf2 UTSW 7 109,929,069 (GRCm39) missense probably damaging 1.00
R8876:Sbf2 UTSW 7 110,049,146 (GRCm39) missense probably damaging 0.99
R8932:Sbf2 UTSW 7 110,040,155 (GRCm39) critical splice donor site probably null
R8954:Sbf2 UTSW 7 110,038,118 (GRCm39) nonsense probably null
R8991:Sbf2 UTSW 7 109,911,896 (GRCm39) missense probably benign 0.20
R9119:Sbf2 UTSW 7 109,911,292 (GRCm39) missense possibly damaging 0.93
R9310:Sbf2 UTSW 7 109,914,292 (GRCm39) missense possibly damaging 0.58
R9344:Sbf2 UTSW 7 109,940,535 (GRCm39) missense probably benign 0.10
R9346:Sbf2 UTSW 7 109,919,946 (GRCm39) missense probably benign 0.05
R9404:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9406:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9408:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9472:Sbf2 UTSW 7 109,970,798 (GRCm39) missense possibly damaging 0.88
R9554:Sbf2 UTSW 7 110,040,671 (GRCm39) missense probably damaging 1.00
R9562:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9624:Sbf2 UTSW 7 109,963,857 (GRCm39) missense probably damaging 1.00
R9652:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9653:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9709:Sbf2 UTSW 7 110,027,514 (GRCm39) missense probably damaging 0.99
RF005:Sbf2 UTSW 7 109,916,215 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAAATTCCTCAGAACCTTC -3'
(R):5'- TTCACAATGTTCAATCCCTCCAAATAG -3'

Sequencing Primer
(F):5'- ATTCCTCAGAACCTTCCATGAATC -3'
(R):5'- ATGGAAACCTGGGTTTTCCAC -3'
Posted On 2020-07-28