Incidental Mutation 'R8305:Arih1'
ID 641012
Institutional Source Beutler Lab
Gene Symbol Arih1
Ensembl Gene ENSMUSG00000025234
Gene Name ariadne RBR E3 ubiquitin protein ligase 1
Synonyms UIP77
MMRRC Submission 067716-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R8305 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 59295541-59393901 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 59303770 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 445 (Q445L)
Ref Sequence ENSEMBL: ENSMUSP00000126531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026264] [ENSMUST00000165322] [ENSMUST00000171856] [ENSMUST00000171975]
AlphaFold Q9Z1K5
Predicted Effect probably benign
Transcript: ENSMUST00000026264
SMART Domains Protein: ENSMUSP00000026264
Gene: ENSMUSG00000025234

DomainStartEndE-ValueType
low complexity region 10 57 N/A INTRINSIC
low complexity region 60 90 N/A INTRINSIC
RING 184 232 1.34e-1 SMART
IBR 254 301 8.2e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165322
AA Change: Q366L

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131516
Gene: ENSMUSG00000025234
AA Change: Q366L

DomainStartEndE-ValueType
low complexity region 10 46 N/A INTRINSIC
RING 105 153 1.34e-1 SMART
IBR 175 236 1.16e-25 SMART
RING 195 266 2.01e0 SMART
IBR 244 308 2.75e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171856
Predicted Effect probably benign
Transcript: ENSMUST00000171975
AA Change: Q445L

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000126531
Gene: ENSMUSG00000025234
AA Change: Q445L

DomainStartEndE-ValueType
low complexity region 10 57 N/A INTRINSIC
low complexity region 60 90 N/A INTRINSIC
RING 184 232 1.34e-1 SMART
IBR 254 315 1.16e-25 SMART
RING 274 345 2.01e0 SMART
IBR 323 387 2.75e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 64,208,844 (GRCm39) E243K possibly damaging Het
Accsl A T 2: 93,696,423 (GRCm39) H58Q probably benign Het
Actl7a T A 4: 56,743,744 (GRCm39) F90L probably benign Het
Adam5 G A 8: 25,300,719 (GRCm39) A270V possibly damaging Het
Angptl3 A G 4: 98,919,548 (GRCm39) T103A probably damaging Het
Ankhd1 T C 18: 36,780,219 (GRCm39) L1757P possibly damaging Het
Apoa4 T A 9: 46,152,453 (GRCm39) M1K probably null Het
Asb14 A T 14: 26,634,054 (GRCm39) I420L probably benign Het
Bbs2 A C 8: 94,800,953 (GRCm39) V626G probably damaging Het
Cep290 C A 10: 100,380,796 (GRCm39) A1678D probably benign Het
Cilp G A 9: 65,186,286 (GRCm39) G794S probably damaging Het
Clca3a1 C T 3: 144,464,927 (GRCm39) probably benign Het
Clca3b T A 3: 144,531,698 (GRCm39) N702I probably damaging Het
Col24a1 T C 3: 145,179,937 (GRCm39) V1143A probably benign Het
Cux1 T C 5: 136,388,863 (GRCm39) T223A probably benign Het
Defa30 A T 8: 21,625,475 (GRCm39) T80S probably benign Het
Dennd1a G A 2: 37,748,093 (GRCm39) L375F probably damaging Het
Dnajc6 C T 4: 101,480,984 (GRCm39) T675I probably damaging Het
Emc9 A G 14: 55,822,556 (GRCm39) V4A probably damaging Het
Enpp3 C G 10: 24,700,827 (GRCm39) probably null Het
Fam117b A G 1: 59,952,782 (GRCm39) T154A probably benign Het
Filip1 G T 9: 79,727,757 (GRCm39) Y287* probably null Het
Flt3 T C 5: 147,284,864 (GRCm39) D751G probably damaging Het
Frem1 T A 4: 82,918,226 (GRCm39) Q572L probably benign Het
Gja10 G A 4: 32,602,441 (GRCm39) probably benign Het
Gm39115 A G 7: 141,689,360 (GRCm39) C138R unknown Het
Gm7356 T A 17: 14,221,699 (GRCm39) Y110F probably benign Het
Igf2r T C 17: 12,952,747 (GRCm39) K233R probably benign Het
Igkv9-129 A T 6: 67,817,206 (GRCm39) E103D probably benign Het
Igsf11 C A 16: 38,827,586 (GRCm39) T48N probably damaging Het
Itpkc A T 7: 26,913,944 (GRCm39) Y506N probably damaging Het
Kat2a A C 11: 100,600,304 (GRCm39) M357R possibly damaging Het
Kbtbd12 T C 6: 88,595,132 (GRCm39) R233G possibly damaging Het
Kcnd2 T A 6: 21,726,197 (GRCm39) C563* probably null Het
Kcnu1 T C 8: 26,382,018 (GRCm39) V456A probably benign Het
Kif24 A G 4: 41,428,825 (GRCm39) V45A probably damaging Het
Macf1 A T 4: 123,289,414 (GRCm39) probably benign Het
Map3k19 T A 1: 127,745,007 (GRCm39) E1177D Het
Mdn1 G T 4: 32,725,107 (GRCm39) L2575F probably benign Het
Mga T A 2: 119,776,800 (GRCm39) M1569K possibly damaging Het
Mvk T C 5: 114,588,840 (GRCm39) Y161H probably damaging Het
Or10al3 T A 17: 38,012,389 (GRCm39) M276K probably benign Het
Or14c44 G T 7: 86,061,987 (GRCm39) C139F probably damaging Het
Or2n1 C A 17: 38,486,464 (GRCm39) T163K probably damaging Het
Pcdhb14 T A 18: 37,583,075 (GRCm39) V727E possibly damaging Het
Pcsk7 T G 9: 45,821,707 (GRCm39) V167G probably damaging Het
Plin5 T C 17: 56,422,221 (GRCm39) D146G probably benign Het
Plxna4 C T 6: 32,188,000 (GRCm39) G879R possibly damaging Het
Prss58 C T 6: 40,872,594 (GRCm39) A171T probably benign Het
Pum1 A G 4: 130,499,231 (GRCm39) I1016V probably benign Het
Rbm43 A G 2: 51,816,712 (GRCm39) V85A probably damaging Het
Rdh16f2 T A 10: 127,712,864 (GRCm39) D287E probably damaging Het
Rptor T A 11: 119,702,812 (GRCm39) L393Q probably damaging Het
Sbf2 T G 7: 109,970,825 (GRCm39) H857P possibly damaging Het
Scn8a A C 15: 100,938,387 (GRCm39) T1919P probably benign Het
Sema6b C T 17: 56,434,084 (GRCm39) G377E probably damaging Het
Senp7 T A 16: 55,975,603 (GRCm39) D436E probably damaging Het
Slc6a17 T A 3: 107,380,901 (GRCm39) I535F probably benign Het
Sptbn2 T A 19: 4,779,158 (GRCm39) S281T possibly damaging Het
Stt3b T C 9: 115,083,999 (GRCm39) I392M probably damaging Het
Tfap2b T C 1: 19,296,660 (GRCm39) V201A possibly damaging Het
Timm10b T C 7: 105,289,876 (GRCm39) probably benign Het
Ttc23 A C 7: 67,312,135 (GRCm39) D14A probably damaging Het
Usp32 A T 11: 84,923,011 (GRCm39) L636I possibly damaging Het
Vgll4 G T 6: 114,867,613 (GRCm39) H79Q probably damaging Het
Vps13d A G 4: 144,818,858 (GRCm39) I3047T Het
Zan T C 5: 137,448,813 (GRCm39) E1680G unknown Het
Other mutations in Arih1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Arih1 APN 9 59,333,452 (GRCm39) missense probably damaging 1.00
IGL02616:Arih1 APN 9 59,319,759 (GRCm39) missense probably benign 0.41
P0037:Arih1 UTSW 9 59,313,076 (GRCm39) missense possibly damaging 0.46
R0411:Arih1 UTSW 9 59,393,266 (GRCm39) missense possibly damaging 0.93
R0416:Arih1 UTSW 9 59,333,993 (GRCm39) splice site probably benign
R0602:Arih1 UTSW 9 59,302,154 (GRCm39) splice site probably benign
R1513:Arih1 UTSW 9 59,310,663 (GRCm39) missense probably damaging 1.00
R1934:Arih1 UTSW 9 59,302,215 (GRCm39) missense probably damaging 1.00
R4880:Arih1 UTSW 9 59,344,168 (GRCm39) missense possibly damaging 0.83
R5023:Arih1 UTSW 9 59,393,515 (GRCm39) missense unknown
R5057:Arih1 UTSW 9 59,393,515 (GRCm39) missense unknown
R5317:Arih1 UTSW 9 59,300,619 (GRCm39) missense probably benign 0.02
R7348:Arih1 UTSW 9 59,393,341 (GRCm39) missense probably damaging 0.98
R8114:Arih1 UTSW 9 59,303,836 (GRCm39) missense probably benign 0.04
R9150:Arih1 UTSW 9 59,344,069 (GRCm39) missense possibly damaging 0.78
R9621:Arih1 UTSW 9 59,393,520 (GRCm39) small deletion probably benign
R9748:Arih1 UTSW 9 59,300,581 (GRCm39) missense possibly damaging 0.85
Z1191:Arih1 UTSW 9 59,393,605 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ACTTGCATGCAGTTCAGTATAACAAAG -3'
(R):5'- GGACACCAGCTTTTGTATATATGTATG -3'

Sequencing Primer
(F):5'- GCAGTTCAGTATAACAAAGAAGGTTC -3'
(R):5'- CCTGCAGAGATACCTGTT -3'
Posted On 2020-07-28