Incidental Mutation 'R8305:Filip1'
ID 641014
Institutional Source Beutler Lab
Gene Symbol Filip1
Ensembl Gene ENSMUSG00000034898
Gene Name filamin A interacting protein 1
Synonyms FILIP, 5730485H21Rik
MMRRC Submission 067716-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.499) question?
Stock # R8305 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 79712376-79920133 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 79727757 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 287 (Y287*)
Ref Sequence ENSEMBL: ENSMUSP00000091329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093811] [ENSMUST00000172973]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000093811
AA Change: Y287*
SMART Domains Protein: ENSMUSP00000091329
Gene: ENSMUSG00000034898
AA Change: Y287*

DomainStartEndE-ValueType
Pfam:CortBP2 71 256 2.1e-64 PFAM
coiled coil region 258 540 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 579 592 N/A INTRINSIC
coiled coil region 625 778 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
low complexity region 1126 1140 N/A INTRINSIC
low complexity region 1168 1180 N/A INTRINSIC
low complexity region 1198 1214 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172973
SMART Domains Protein: ENSMUSP00000134427
Gene: ENSMUSG00000034898

DomainStartEndE-ValueType
Pfam:CortBP2 65 225 5.2e-74 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamin A binding protein. The encoded protein promotes the degradation of filamin A and may regulate cortical neuron migration and dendritic spine morphology. Mice lacking a functional copy of this gene exhibit reduced dendritic spine length and altered excitatory signaling. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 64,208,844 (GRCm39) E243K possibly damaging Het
Accsl A T 2: 93,696,423 (GRCm39) H58Q probably benign Het
Actl7a T A 4: 56,743,744 (GRCm39) F90L probably benign Het
Adam5 G A 8: 25,300,719 (GRCm39) A270V possibly damaging Het
Angptl3 A G 4: 98,919,548 (GRCm39) T103A probably damaging Het
Ankhd1 T C 18: 36,780,219 (GRCm39) L1757P possibly damaging Het
Apoa4 T A 9: 46,152,453 (GRCm39) M1K probably null Het
Arih1 T A 9: 59,303,770 (GRCm39) Q445L probably benign Het
Asb14 A T 14: 26,634,054 (GRCm39) I420L probably benign Het
Bbs2 A C 8: 94,800,953 (GRCm39) V626G probably damaging Het
Cep290 C A 10: 100,380,796 (GRCm39) A1678D probably benign Het
Cilp G A 9: 65,186,286 (GRCm39) G794S probably damaging Het
Clca3a1 C T 3: 144,464,927 (GRCm39) probably benign Het
Clca3b T A 3: 144,531,698 (GRCm39) N702I probably damaging Het
Col24a1 T C 3: 145,179,937 (GRCm39) V1143A probably benign Het
Cux1 T C 5: 136,388,863 (GRCm39) T223A probably benign Het
Defa30 A T 8: 21,625,475 (GRCm39) T80S probably benign Het
Dennd1a G A 2: 37,748,093 (GRCm39) L375F probably damaging Het
Dnajc6 C T 4: 101,480,984 (GRCm39) T675I probably damaging Het
Emc9 A G 14: 55,822,556 (GRCm39) V4A probably damaging Het
Enpp3 C G 10: 24,700,827 (GRCm39) probably null Het
Fam117b A G 1: 59,952,782 (GRCm39) T154A probably benign Het
Flt3 T C 5: 147,284,864 (GRCm39) D751G probably damaging Het
Frem1 T A 4: 82,918,226 (GRCm39) Q572L probably benign Het
Gja10 G A 4: 32,602,441 (GRCm39) probably benign Het
Gm39115 A G 7: 141,689,360 (GRCm39) C138R unknown Het
Gm7356 T A 17: 14,221,699 (GRCm39) Y110F probably benign Het
Igf2r T C 17: 12,952,747 (GRCm39) K233R probably benign Het
Igkv9-129 A T 6: 67,817,206 (GRCm39) E103D probably benign Het
Igsf11 C A 16: 38,827,586 (GRCm39) T48N probably damaging Het
Itpkc A T 7: 26,913,944 (GRCm39) Y506N probably damaging Het
Kat2a A C 11: 100,600,304 (GRCm39) M357R possibly damaging Het
Kbtbd12 T C 6: 88,595,132 (GRCm39) R233G possibly damaging Het
Kcnd2 T A 6: 21,726,197 (GRCm39) C563* probably null Het
Kcnu1 T C 8: 26,382,018 (GRCm39) V456A probably benign Het
Kif24 A G 4: 41,428,825 (GRCm39) V45A probably damaging Het
Macf1 A T 4: 123,289,414 (GRCm39) probably benign Het
Map3k19 T A 1: 127,745,007 (GRCm39) E1177D Het
Mdn1 G T 4: 32,725,107 (GRCm39) L2575F probably benign Het
Mga T A 2: 119,776,800 (GRCm39) M1569K possibly damaging Het
Mvk T C 5: 114,588,840 (GRCm39) Y161H probably damaging Het
Or10al3 T A 17: 38,012,389 (GRCm39) M276K probably benign Het
Or14c44 G T 7: 86,061,987 (GRCm39) C139F probably damaging Het
Or2n1 C A 17: 38,486,464 (GRCm39) T163K probably damaging Het
Pcdhb14 T A 18: 37,583,075 (GRCm39) V727E possibly damaging Het
Pcsk7 T G 9: 45,821,707 (GRCm39) V167G probably damaging Het
Plin5 T C 17: 56,422,221 (GRCm39) D146G probably benign Het
Plxna4 C T 6: 32,188,000 (GRCm39) G879R possibly damaging Het
Prss58 C T 6: 40,872,594 (GRCm39) A171T probably benign Het
Pum1 A G 4: 130,499,231 (GRCm39) I1016V probably benign Het
Rbm43 A G 2: 51,816,712 (GRCm39) V85A probably damaging Het
Rdh16f2 T A 10: 127,712,864 (GRCm39) D287E probably damaging Het
Rptor T A 11: 119,702,812 (GRCm39) L393Q probably damaging Het
Sbf2 T G 7: 109,970,825 (GRCm39) H857P possibly damaging Het
Scn8a A C 15: 100,938,387 (GRCm39) T1919P probably benign Het
Sema6b C T 17: 56,434,084 (GRCm39) G377E probably damaging Het
Senp7 T A 16: 55,975,603 (GRCm39) D436E probably damaging Het
Slc6a17 T A 3: 107,380,901 (GRCm39) I535F probably benign Het
Sptbn2 T A 19: 4,779,158 (GRCm39) S281T possibly damaging Het
Stt3b T C 9: 115,083,999 (GRCm39) I392M probably damaging Het
Tfap2b T C 1: 19,296,660 (GRCm39) V201A possibly damaging Het
Timm10b T C 7: 105,289,876 (GRCm39) probably benign Het
Ttc23 A C 7: 67,312,135 (GRCm39) D14A probably damaging Het
Usp32 A T 11: 84,923,011 (GRCm39) L636I possibly damaging Het
Vgll4 G T 6: 114,867,613 (GRCm39) H79Q probably damaging Het
Vps13d A G 4: 144,818,858 (GRCm39) I3047T Het
Zan T C 5: 137,448,813 (GRCm39) E1680G unknown Het
Other mutations in Filip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Filip1 APN 9 79,725,226 (GRCm39) missense probably damaging 1.00
IGL01101:Filip1 APN 9 79,805,528 (GRCm39) missense probably benign 0.44
IGL01301:Filip1 APN 9 79,726,462 (GRCm39) missense possibly damaging 0.93
IGL01887:Filip1 APN 9 79,726,899 (GRCm39) missense probably benign 0.42
IGL02119:Filip1 APN 9 79,725,548 (GRCm39) missense probably benign
IGL02285:Filip1 APN 9 79,727,408 (GRCm39) missense probably damaging 1.00
IGL02395:Filip1 APN 9 79,805,692 (GRCm39) missense probably benign 0.01
IGL03398:Filip1 APN 9 79,726,225 (GRCm39) missense probably benign 0.03
IGL03400:Filip1 APN 9 79,727,755 (GRCm39) missense probably benign 0.01
IGL03404:Filip1 APN 9 79,725,841 (GRCm39) missense probably damaging 0.99
ANU18:Filip1 UTSW 9 79,726,462 (GRCm39) missense possibly damaging 0.93
BB010:Filip1 UTSW 9 79,727,329 (GRCm39) missense possibly damaging 0.65
BB020:Filip1 UTSW 9 79,727,329 (GRCm39) missense possibly damaging 0.65
R0101:Filip1 UTSW 9 79,726,810 (GRCm39) missense probably benign 0.04
R0243:Filip1 UTSW 9 79,726,285 (GRCm39) missense probably damaging 0.98
R0244:Filip1 UTSW 9 79,726,744 (GRCm39) missense possibly damaging 0.87
R0371:Filip1 UTSW 9 79,767,373 (GRCm39) missense probably damaging 1.00
R0399:Filip1 UTSW 9 79,725,592 (GRCm39) missense possibly damaging 0.71
R0412:Filip1 UTSW 9 79,727,571 (GRCm39) missense possibly damaging 0.59
R0671:Filip1 UTSW 9 79,726,672 (GRCm39) missense probably damaging 1.00
R1314:Filip1 UTSW 9 79,727,848 (GRCm39) missense probably damaging 1.00
R1465:Filip1 UTSW 9 79,805,589 (GRCm39) missense probably benign 0.25
R1465:Filip1 UTSW 9 79,805,589 (GRCm39) missense probably benign 0.25
R1602:Filip1 UTSW 9 79,727,873 (GRCm39) missense probably damaging 0.99
R1801:Filip1 UTSW 9 79,723,128 (GRCm39) missense probably damaging 0.98
R1929:Filip1 UTSW 9 79,727,212 (GRCm39) missense probably damaging 1.00
R1983:Filip1 UTSW 9 79,767,374 (GRCm39) missense probably damaging 1.00
R2066:Filip1 UTSW 9 79,727,498 (GRCm39) missense probably damaging 1.00
R2128:Filip1 UTSW 9 79,726,612 (GRCm39) missense probably damaging 0.99
R2271:Filip1 UTSW 9 79,727,212 (GRCm39) missense probably damaging 1.00
R2411:Filip1 UTSW 9 79,805,715 (GRCm39) missense probably damaging 0.98
R3429:Filip1 UTSW 9 79,760,952 (GRCm39) missense probably damaging 1.00
R3430:Filip1 UTSW 9 79,760,952 (GRCm39) missense probably damaging 1.00
R3945:Filip1 UTSW 9 79,725,649 (GRCm39) missense probably benign 0.01
R4007:Filip1 UTSW 9 79,726,009 (GRCm39) missense possibly damaging 0.71
R4583:Filip1 UTSW 9 79,723,091 (GRCm39) missense possibly damaging 0.76
R4803:Filip1 UTSW 9 79,727,396 (GRCm39) missense probably benign 0.05
R4837:Filip1 UTSW 9 79,726,741 (GRCm39) missense probably damaging 0.98
R4910:Filip1 UTSW 9 79,725,214 (GRCm39) missense probably benign 0.00
R4929:Filip1 UTSW 9 79,727,029 (GRCm39) missense probably benign 0.07
R5387:Filip1 UTSW 9 79,725,556 (GRCm39) missense probably benign
R5581:Filip1 UTSW 9 79,727,042 (GRCm39) missense possibly damaging 0.95
R5808:Filip1 UTSW 9 79,725,983 (GRCm39) missense possibly damaging 0.67
R5891:Filip1 UTSW 9 79,727,142 (GRCm39) missense possibly damaging 0.69
R6166:Filip1 UTSW 9 79,726,736 (GRCm39) missense probably damaging 0.99
R6273:Filip1 UTSW 9 79,723,168 (GRCm39) missense probably benign 0.01
R6380:Filip1 UTSW 9 79,726,906 (GRCm39) missense probably damaging 0.99
R6385:Filip1 UTSW 9 79,727,813 (GRCm39) missense possibly damaging 0.68
R6614:Filip1 UTSW 9 79,723,121 (GRCm39) missense probably damaging 1.00
R6715:Filip1 UTSW 9 79,726,040 (GRCm39) missense probably benign 0.03
R7047:Filip1 UTSW 9 79,760,916 (GRCm39) missense probably damaging 0.98
R7126:Filip1 UTSW 9 79,805,577 (GRCm39) missense possibly damaging 0.88
R7144:Filip1 UTSW 9 79,727,495 (GRCm39) missense possibly damaging 0.65
R7218:Filip1 UTSW 9 79,725,356 (GRCm39) missense probably benign
R7404:Filip1 UTSW 9 79,727,380 (GRCm39) missense possibly damaging 0.94
R7702:Filip1 UTSW 9 79,727,931 (GRCm39) missense probably benign 0.20
R7866:Filip1 UTSW 9 79,726,225 (GRCm39) missense probably benign 0.03
R7933:Filip1 UTSW 9 79,727,329 (GRCm39) missense possibly damaging 0.65
R8012:Filip1 UTSW 9 79,725,241 (GRCm39) missense probably damaging 0.97
R8097:Filip1 UTSW 9 79,725,541 (GRCm39) missense probably benign
R8213:Filip1 UTSW 9 79,725,374 (GRCm39) missense probably benign 0.01
R8798:Filip1 UTSW 9 79,727,372 (GRCm39) missense possibly damaging 0.94
R9184:Filip1 UTSW 9 79,805,542 (GRCm39) missense probably benign 0.03
R9322:Filip1 UTSW 9 79,727,014 (GRCm39) missense probably benign 0.01
R9334:Filip1 UTSW 9 79,725,739 (GRCm39) missense probably benign 0.32
R9353:Filip1 UTSW 9 79,725,623 (GRCm39) missense possibly damaging 0.67
R9541:Filip1 UTSW 9 79,727,135 (GRCm39) nonsense probably null
R9607:Filip1 UTSW 9 79,726,402 (GRCm39) missense probably damaging 1.00
X0054:Filip1 UTSW 9 79,726,817 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCCTCGGCCTTCTGAAGAC -3'
(R):5'- CCTTGAGCAAGAAAAGGCTTAC -3'

Sequencing Primer
(F):5'- GAAGACTTTTATTGGTCTCTTCCAG -3'
(R):5'- TTACCAAGCCCGCAAAGAAAAGG -3'
Posted On 2020-07-28