Incidental Mutation 'R8305:Cep290'
ID 641017
Institutional Source Beutler Lab
Gene Symbol Cep290
Ensembl Gene ENSMUSG00000019971
Gene Name centrosomal protein 290
Synonyms Kiaa, Nphp6, b2b1752Clo, b2b1454Clo
MMRRC Submission 067716-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.953) question?
Stock # R8305 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 100323410-100409527 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 100380796 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 1678 (A1678D)
Ref Sequence ENSEMBL: ENSMUSP00000130899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164751]
AlphaFold Q6A078
Predicted Effect probably benign
Transcript: ENSMUST00000164751
AA Change: A1678D

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000130899
Gene: ENSMUSG00000019971
AA Change: A1678D

DomainStartEndE-ValueType
coiled coil region 59 298 N/A INTRINSIC
coiled coil region 319 566 N/A INTRINSIC
coiled coil region 598 662 N/A INTRINSIC
coiled coil region 697 754 N/A INTRINSIC
coiled coil region 780 875 N/A INTRINSIC
internal_repeat_2 884 894 1.1e-5 PROSPERO
coiled coil region 986 1028 N/A INTRINSIC
internal_repeat_2 1057 1067 1.1e-5 PROSPERO
coiled coil region 1071 1109 N/A INTRINSIC
low complexity region 1140 1156 N/A INTRINSIC
internal_repeat_1 1176 1206 8.72e-8 PROSPERO
coiled coil region 1221 1250 N/A INTRINSIC
Pfam:CEP209_CC5 1290 1417 3.8e-55 PFAM
low complexity region 1476 1493 N/A INTRINSIC
internal_repeat_1 1498 1525 8.72e-8 PROSPERO
coiled coil region 1535 1595 N/A INTRINSIC
coiled coil region 1624 1716 N/A INTRINSIC
coiled coil region 1776 2328 N/A INTRINSIC
low complexity region 2333 2347 N/A INTRINSIC
coiled coil region 2377 2453 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice display mislocalization of ciliary and phototransduction proteins resulting in early-onset retinal degeneration. Heterotaxy with transposition of the great arteries (TGA), atrioventricular septal defect (AVSD), left bronchial isomerism, and hypoplastic spleen is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 64,208,844 (GRCm39) E243K possibly damaging Het
Accsl A T 2: 93,696,423 (GRCm39) H58Q probably benign Het
Actl7a T A 4: 56,743,744 (GRCm39) F90L probably benign Het
Adam5 G A 8: 25,300,719 (GRCm39) A270V possibly damaging Het
Angptl3 A G 4: 98,919,548 (GRCm39) T103A probably damaging Het
Ankhd1 T C 18: 36,780,219 (GRCm39) L1757P possibly damaging Het
Apoa4 T A 9: 46,152,453 (GRCm39) M1K probably null Het
Arih1 T A 9: 59,303,770 (GRCm39) Q445L probably benign Het
Asb14 A T 14: 26,634,054 (GRCm39) I420L probably benign Het
Bbs2 A C 8: 94,800,953 (GRCm39) V626G probably damaging Het
Cilp G A 9: 65,186,286 (GRCm39) G794S probably damaging Het
Clca3a1 C T 3: 144,464,927 (GRCm39) probably benign Het
Clca3b T A 3: 144,531,698 (GRCm39) N702I probably damaging Het
Col24a1 T C 3: 145,179,937 (GRCm39) V1143A probably benign Het
Cux1 T C 5: 136,388,863 (GRCm39) T223A probably benign Het
Defa30 A T 8: 21,625,475 (GRCm39) T80S probably benign Het
Dennd1a G A 2: 37,748,093 (GRCm39) L375F probably damaging Het
Dnajc6 C T 4: 101,480,984 (GRCm39) T675I probably damaging Het
Emc9 A G 14: 55,822,556 (GRCm39) V4A probably damaging Het
Enpp3 C G 10: 24,700,827 (GRCm39) probably null Het
Fam117b A G 1: 59,952,782 (GRCm39) T154A probably benign Het
Filip1 G T 9: 79,727,757 (GRCm39) Y287* probably null Het
Flt3 T C 5: 147,284,864 (GRCm39) D751G probably damaging Het
Frem1 T A 4: 82,918,226 (GRCm39) Q572L probably benign Het
Gja10 G A 4: 32,602,441 (GRCm39) probably benign Het
Gm39115 A G 7: 141,689,360 (GRCm39) C138R unknown Het
Gm7356 T A 17: 14,221,699 (GRCm39) Y110F probably benign Het
Igf2r T C 17: 12,952,747 (GRCm39) K233R probably benign Het
Igkv9-129 A T 6: 67,817,206 (GRCm39) E103D probably benign Het
Igsf11 C A 16: 38,827,586 (GRCm39) T48N probably damaging Het
Itpkc A T 7: 26,913,944 (GRCm39) Y506N probably damaging Het
Kat2a A C 11: 100,600,304 (GRCm39) M357R possibly damaging Het
Kbtbd12 T C 6: 88,595,132 (GRCm39) R233G possibly damaging Het
Kcnd2 T A 6: 21,726,197 (GRCm39) C563* probably null Het
Kcnu1 T C 8: 26,382,018 (GRCm39) V456A probably benign Het
Kif24 A G 4: 41,428,825 (GRCm39) V45A probably damaging Het
Macf1 A T 4: 123,289,414 (GRCm39) probably benign Het
Map3k19 T A 1: 127,745,007 (GRCm39) E1177D Het
Mdn1 G T 4: 32,725,107 (GRCm39) L2575F probably benign Het
Mga T A 2: 119,776,800 (GRCm39) M1569K possibly damaging Het
Mvk T C 5: 114,588,840 (GRCm39) Y161H probably damaging Het
Or10al3 T A 17: 38,012,389 (GRCm39) M276K probably benign Het
Or14c44 G T 7: 86,061,987 (GRCm39) C139F probably damaging Het
Or2n1 C A 17: 38,486,464 (GRCm39) T163K probably damaging Het
Pcdhb14 T A 18: 37,583,075 (GRCm39) V727E possibly damaging Het
Pcsk7 T G 9: 45,821,707 (GRCm39) V167G probably damaging Het
Plin5 T C 17: 56,422,221 (GRCm39) D146G probably benign Het
Plxna4 C T 6: 32,188,000 (GRCm39) G879R possibly damaging Het
Prss58 C T 6: 40,872,594 (GRCm39) A171T probably benign Het
Pum1 A G 4: 130,499,231 (GRCm39) I1016V probably benign Het
Rbm43 A G 2: 51,816,712 (GRCm39) V85A probably damaging Het
Rdh16f2 T A 10: 127,712,864 (GRCm39) D287E probably damaging Het
Rptor T A 11: 119,702,812 (GRCm39) L393Q probably damaging Het
Sbf2 T G 7: 109,970,825 (GRCm39) H857P possibly damaging Het
Scn8a A C 15: 100,938,387 (GRCm39) T1919P probably benign Het
Sema6b C T 17: 56,434,084 (GRCm39) G377E probably damaging Het
Senp7 T A 16: 55,975,603 (GRCm39) D436E probably damaging Het
Slc6a17 T A 3: 107,380,901 (GRCm39) I535F probably benign Het
Sptbn2 T A 19: 4,779,158 (GRCm39) S281T possibly damaging Het
Stt3b T C 9: 115,083,999 (GRCm39) I392M probably damaging Het
Tfap2b T C 1: 19,296,660 (GRCm39) V201A possibly damaging Het
Timm10b T C 7: 105,289,876 (GRCm39) probably benign Het
Ttc23 A C 7: 67,312,135 (GRCm39) D14A probably damaging Het
Usp32 A T 11: 84,923,011 (GRCm39) L636I possibly damaging Het
Vgll4 G T 6: 114,867,613 (GRCm39) H79Q probably damaging Het
Vps13d A G 4: 144,818,858 (GRCm39) I3047T Het
Zan T C 5: 137,448,813 (GRCm39) E1680G unknown Het
Other mutations in Cep290
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Cep290 APN 10 100,344,586 (GRCm39) missense probably benign 0.00
IGL00499:Cep290 APN 10 100,379,189 (GRCm39) missense probably damaging 1.00
IGL00547:Cep290 APN 10 100,346,570 (GRCm39) missense probably damaging 0.99
IGL00573:Cep290 APN 10 100,376,223 (GRCm39) missense probably damaging 1.00
IGL00646:Cep290 APN 10 100,337,016 (GRCm39) missense probably benign 0.15
IGL00755:Cep290 APN 10 100,366,966 (GRCm39) missense probably damaging 1.00
IGL00835:Cep290 APN 10 100,399,242 (GRCm39) nonsense probably null
IGL00846:Cep290 APN 10 100,376,195 (GRCm39) splice site probably benign
IGL00985:Cep290 APN 10 100,403,023 (GRCm39) splice site probably benign
IGL01687:Cep290 APN 10 100,336,067 (GRCm39) missense probably damaging 1.00
IGL01782:Cep290 APN 10 100,380,987 (GRCm39) nonsense probably null
IGL02010:Cep290 APN 10 100,397,207 (GRCm39) missense probably benign 0.00
IGL02010:Cep290 APN 10 100,344,569 (GRCm39) missense probably benign 0.39
IGL02036:Cep290 APN 10 100,393,962 (GRCm39) nonsense probably null
IGL02039:Cep290 APN 10 100,350,464 (GRCm39) critical splice donor site probably null
IGL02532:Cep290 APN 10 100,380,927 (GRCm39) missense probably benign 0.04
IGL02950:Cep290 APN 10 100,376,191 (GRCm39) splice site probably benign
IGL03105:Cep290 APN 10 100,387,686 (GRCm39) missense possibly damaging 0.66
IGL03179:Cep290 APN 10 100,403,950 (GRCm39) missense possibly damaging 0.60
IGL03271:Cep290 APN 10 100,373,663 (GRCm39) missense probably benign 0.09
IGL03401:Cep290 APN 10 100,336,127 (GRCm39) missense probably benign 0.27
PIT4687001:Cep290 UTSW 10 100,373,453 (GRCm39) missense probably benign 0.28
R0025:Cep290 UTSW 10 100,373,693 (GRCm39) missense probably damaging 1.00
R0127:Cep290 UTSW 10 100,372,787 (GRCm39) splice site probably benign
R0254:Cep290 UTSW 10 100,350,436 (GRCm39) missense probably benign 0.31
R0295:Cep290 UTSW 10 100,373,683 (GRCm39) missense probably damaging 0.99
R0371:Cep290 UTSW 10 100,354,426 (GRCm39) splice site probably benign
R0390:Cep290 UTSW 10 100,344,620 (GRCm39) missense probably benign 0.09
R0399:Cep290 UTSW 10 100,390,262 (GRCm39) splice site probably benign
R0413:Cep290 UTSW 10 100,359,176 (GRCm39) nonsense probably null
R0427:Cep290 UTSW 10 100,352,041 (GRCm39) missense probably benign 0.01
R0472:Cep290 UTSW 10 100,387,317 (GRCm39) missense probably benign 0.19
R0485:Cep290 UTSW 10 100,385,206 (GRCm39) missense possibly damaging 0.94
R0635:Cep290 UTSW 10 100,328,538 (GRCm39) missense probably damaging 1.00
R0675:Cep290 UTSW 10 100,404,675 (GRCm39) critical splice acceptor site probably null
R0972:Cep290 UTSW 10 100,354,624 (GRCm39) missense probably benign 0.08
R1238:Cep290 UTSW 10 100,353,725 (GRCm39) missense probably damaging 1.00
R1297:Cep290 UTSW 10 100,374,962 (GRCm39) splice site probably benign
R1368:Cep290 UTSW 10 100,330,828 (GRCm39) splice site probably benign
R1394:Cep290 UTSW 10 100,373,391 (GRCm39) missense possibly damaging 0.66
R1437:Cep290 UTSW 10 100,407,963 (GRCm39) missense probably benign 0.00
R1493:Cep290 UTSW 10 100,398,043 (GRCm39) missense probably benign 0.21
R1496:Cep290 UTSW 10 100,374,828 (GRCm39) missense probably damaging 1.00
R1539:Cep290 UTSW 10 100,332,690 (GRCm39) missense probably benign 0.06
R1598:Cep290 UTSW 10 100,385,191 (GRCm39) missense probably damaging 1.00
R1616:Cep290 UTSW 10 100,404,698 (GRCm39) missense probably benign
R1712:Cep290 UTSW 10 100,390,361 (GRCm39) missense probably benign 0.02
R1753:Cep290 UTSW 10 100,349,843 (GRCm39) missense probably benign
R1773:Cep290 UTSW 10 100,346,435 (GRCm39) missense probably benign
R1775:Cep290 UTSW 10 100,332,672 (GRCm39) missense probably damaging 0.98
R1799:Cep290 UTSW 10 100,352,058 (GRCm39) missense probably benign 0.00
R1937:Cep290 UTSW 10 100,333,815 (GRCm39) missense possibly damaging 0.71
R1991:Cep290 UTSW 10 100,367,046 (GRCm39) missense possibly damaging 0.80
R2031:Cep290 UTSW 10 100,348,262 (GRCm39) critical splice donor site probably null
R2164:Cep290 UTSW 10 100,354,657 (GRCm39) missense probably damaging 0.96
R2393:Cep290 UTSW 10 100,397,100 (GRCm39) critical splice acceptor site probably null
R2403:Cep290 UTSW 10 100,373,299 (GRCm39) missense probably benign 0.19
R3612:Cep290 UTSW 10 100,377,443 (GRCm39) nonsense probably null
R3800:Cep290 UTSW 10 100,408,803 (GRCm39) missense probably damaging 0.97
R4005:Cep290 UTSW 10 100,374,870 (GRCm39) missense probably damaging 1.00
R4039:Cep290 UTSW 10 100,348,263 (GRCm39) critical splice donor site probably null
R4259:Cep290 UTSW 10 100,350,354 (GRCm39) missense probably damaging 1.00
R4260:Cep290 UTSW 10 100,350,354 (GRCm39) missense probably damaging 1.00
R4319:Cep290 UTSW 10 100,374,909 (GRCm39) missense probably benign 0.09
R4329:Cep290 UTSW 10 100,373,530 (GRCm39) missense probably damaging 0.98
R4573:Cep290 UTSW 10 100,354,712 (GRCm39) missense probably benign
R4614:Cep290 UTSW 10 100,395,549 (GRCm39) missense possibly damaging 0.93
R4614:Cep290 UTSW 10 100,344,602 (GRCm39) missense probably benign
R4708:Cep290 UTSW 10 100,359,126 (GRCm39) missense probably benign 0.02
R4727:Cep290 UTSW 10 100,399,132 (GRCm39) missense probably benign 0.05
R4825:Cep290 UTSW 10 100,324,210 (GRCm39) missense probably damaging 0.96
R4839:Cep290 UTSW 10 100,344,648 (GRCm39) missense probably damaging 0.99
R4858:Cep290 UTSW 10 100,330,773 (GRCm39) missense probably benign 0.31
R4871:Cep290 UTSW 10 100,384,776 (GRCm39) missense probably benign 0.22
R5094:Cep290 UTSW 10 100,402,892 (GRCm39) missense probably damaging 0.97
R5103:Cep290 UTSW 10 100,374,882 (GRCm39) missense probably damaging 1.00
R5499:Cep290 UTSW 10 100,373,515 (GRCm39) missense probably damaging 0.99
R5505:Cep290 UTSW 10 100,335,048 (GRCm39) critical splice donor site probably null
R5615:Cep290 UTSW 10 100,367,012 (GRCm39) missense probably damaging 1.00
R5815:Cep290 UTSW 10 100,393,970 (GRCm39) missense possibly damaging 0.80
R5883:Cep290 UTSW 10 100,359,261 (GRCm39) missense probably benign 0.44
R5889:Cep290 UTSW 10 100,334,936 (GRCm39) missense possibly damaging 0.95
R5928:Cep290 UTSW 10 100,387,692 (GRCm39) missense probably damaging 0.99
R5992:Cep290 UTSW 10 100,379,183 (GRCm39) missense possibly damaging 0.73
R6000:Cep290 UTSW 10 100,377,649 (GRCm39) missense probably damaging 1.00
R6213:Cep290 UTSW 10 100,359,222 (GRCm39) missense probably benign 0.06
R6274:Cep290 UTSW 10 100,366,069 (GRCm39) missense probably damaging 1.00
R6285:Cep290 UTSW 10 100,359,191 (GRCm39) missense probably benign 0.17
R6306:Cep290 UTSW 10 100,367,028 (GRCm39) missense possibly damaging 0.89
R6593:Cep290 UTSW 10 100,344,638 (GRCm39) missense probably benign 0.01
R6649:Cep290 UTSW 10 100,354,393 (GRCm39) missense probably benign 0.28
R6692:Cep290 UTSW 10 100,405,006 (GRCm39) splice site probably null
R6788:Cep290 UTSW 10 100,324,490 (GRCm39) missense probably damaging 1.00
R6847:Cep290 UTSW 10 100,399,281 (GRCm39) missense probably damaging 1.00
R6947:Cep290 UTSW 10 100,365,918 (GRCm39) missense probably damaging 1.00
R7035:Cep290 UTSW 10 100,334,933 (GRCm39) missense probably benign 0.07
R7073:Cep290 UTSW 10 100,374,865 (GRCm39) missense possibly damaging 0.90
R7114:Cep290 UTSW 10 100,379,220 (GRCm39) missense probably damaging 0.98
R7256:Cep290 UTSW 10 100,382,360 (GRCm39) missense probably damaging 1.00
R7258:Cep290 UTSW 10 100,334,970 (GRCm39) missense probably benign 0.01
R7311:Cep290 UTSW 10 100,373,580 (GRCm39) missense probably damaging 0.98
R7505:Cep290 UTSW 10 100,352,127 (GRCm39) missense probably benign 0.01
R7615:Cep290 UTSW 10 100,328,543 (GRCm39) missense probably benign 0.03
R7643:Cep290 UTSW 10 100,373,415 (GRCm39) missense probably benign
R7662:Cep290 UTSW 10 100,373,665 (GRCm39) missense probably benign 0.21
R7663:Cep290 UTSW 10 100,390,398 (GRCm39) critical splice donor site probably null
R7685:Cep290 UTSW 10 100,375,919 (GRCm39) missense probably benign 0.19
R7699:Cep290 UTSW 10 100,376,231 (GRCm39) missense probably benign 0.33
R7717:Cep290 UTSW 10 100,328,543 (GRCm39) missense probably benign 0.03
R7747:Cep290 UTSW 10 100,394,038 (GRCm39) nonsense probably null
R7757:Cep290 UTSW 10 100,399,296 (GRCm39) missense probably benign
R7843:Cep290 UTSW 10 100,352,050 (GRCm39) missense possibly damaging 0.49
R7905:Cep290 UTSW 10 100,390,352 (GRCm39) missense probably benign
R8078:Cep290 UTSW 10 100,408,749 (GRCm39) missense probably benign 0.04
R8081:Cep290 UTSW 10 100,394,038 (GRCm39) nonsense probably null
R8094:Cep290 UTSW 10 100,380,793 (GRCm39) missense possibly damaging 0.95
R8266:Cep290 UTSW 10 100,395,533 (GRCm39) missense probably benign 0.08
R8325:Cep290 UTSW 10 100,353,670 (GRCm39) missense probably benign 0.03
R8372:Cep290 UTSW 10 100,385,203 (GRCm39) missense probably benign 0.00
R8443:Cep290 UTSW 10 100,331,706 (GRCm39) missense possibly damaging 0.80
R8497:Cep290 UTSW 10 100,387,320 (GRCm39) missense probably damaging 1.00
R8778:Cep290 UTSW 10 100,350,374 (GRCm39) nonsense probably null
R8975:Cep290 UTSW 10 100,349,782 (GRCm39) missense possibly damaging 0.54
R9146:Cep290 UTSW 10 100,377,665 (GRCm39) missense probably benign 0.44
R9264:Cep290 UTSW 10 100,333,878 (GRCm39) missense possibly damaging 0.86
R9374:Cep290 UTSW 10 100,372,729 (GRCm39) missense probably damaging 0.98
R9448:Cep290 UTSW 10 100,395,546 (GRCm39) missense probably benign 0.32
R9499:Cep290 UTSW 10 100,372,729 (GRCm39) missense probably damaging 0.98
R9507:Cep290 UTSW 10 100,330,785 (GRCm39) missense possibly damaging 0.81
R9539:Cep290 UTSW 10 100,404,713 (GRCm39) missense probably damaging 1.00
R9547:Cep290 UTSW 10 100,380,841 (GRCm39) missense probably benign 0.00
R9551:Cep290 UTSW 10 100,372,729 (GRCm39) missense probably damaging 0.98
R9657:Cep290 UTSW 10 100,351,003 (GRCm39) missense possibly damaging 0.93
R9731:Cep290 UTSW 10 100,346,404 (GRCm39) missense probably damaging 0.98
R9756:Cep290 UTSW 10 100,352,034 (GRCm39) missense probably damaging 0.97
R9777:Cep290 UTSW 10 100,354,529 (GRCm39) missense probably benign 0.01
Z1176:Cep290 UTSW 10 100,385,236 (GRCm39) critical splice donor site probably benign
Z1177:Cep290 UTSW 10 100,374,859 (GRCm39) missense possibly damaging 0.89
Z1177:Cep290 UTSW 10 100,333,806 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAGTATGTAAGTAGCTGCCAC -3'
(R):5'- TTCTCTTTCAAGGCTAGTTGGC -3'

Sequencing Primer
(F):5'- TAGAGCTCACTGGACAGTCTACG -3'
(R):5'- GCTCTTTAGCCTGTCTACAAGATTC -3'
Posted On 2020-07-28