Incidental Mutation 'R8305:Usp32'
ID 641019
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Name ubiquitin specific peptidase 32
Synonyms 2900074J03Rik, 6430526O11Rik
MMRRC Submission 067716-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8305 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 84875268-85030987 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 84923011 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Isoleucine at position 636 (L636I)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075] [ENSMUST00000172515]
AlphaFold F8VPZ3
Predicted Effect probably benign
Transcript: ENSMUST00000000821
SMART Domains Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Pfam:UCH 32 260 4.1e-51 PFAM
Pfam:UCH_1 33 228 1.7e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108075
AA Change: L636I

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: L636I

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172515
SMART Domains Protein: ENSMUSP00000133781
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Blast:DUSP 1 52 7e-30 BLAST
low complexity region 53 65 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000134476
Gene: ENSMUSG00000000804
AA Change: L140I

DomainStartEndE-ValueType
Pfam:DUSP 1 65 6.5e-17 PFAM
Pfam:Ubiquitin_3 122 216 8e-10 PFAM
Pfam:UCH 238 257 1.2e-7 PFAM
Meta Mutation Damage Score 0.2415 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 64,208,844 (GRCm39) E243K possibly damaging Het
Accsl A T 2: 93,696,423 (GRCm39) H58Q probably benign Het
Actl7a T A 4: 56,743,744 (GRCm39) F90L probably benign Het
Adam5 G A 8: 25,300,719 (GRCm39) A270V possibly damaging Het
Angptl3 A G 4: 98,919,548 (GRCm39) T103A probably damaging Het
Ankhd1 T C 18: 36,780,219 (GRCm39) L1757P possibly damaging Het
Apoa4 T A 9: 46,152,453 (GRCm39) M1K probably null Het
Arih1 T A 9: 59,303,770 (GRCm39) Q445L probably benign Het
Asb14 A T 14: 26,634,054 (GRCm39) I420L probably benign Het
Bbs2 A C 8: 94,800,953 (GRCm39) V626G probably damaging Het
Cep290 C A 10: 100,380,796 (GRCm39) A1678D probably benign Het
Cilp G A 9: 65,186,286 (GRCm39) G794S probably damaging Het
Clca3a1 C T 3: 144,464,927 (GRCm39) probably benign Het
Clca3b T A 3: 144,531,698 (GRCm39) N702I probably damaging Het
Col24a1 T C 3: 145,179,937 (GRCm39) V1143A probably benign Het
Cux1 T C 5: 136,388,863 (GRCm39) T223A probably benign Het
Defa30 A T 8: 21,625,475 (GRCm39) T80S probably benign Het
Dennd1a G A 2: 37,748,093 (GRCm39) L375F probably damaging Het
Dnajc6 C T 4: 101,480,984 (GRCm39) T675I probably damaging Het
Emc9 A G 14: 55,822,556 (GRCm39) V4A probably damaging Het
Enpp3 C G 10: 24,700,827 (GRCm39) probably null Het
Fam117b A G 1: 59,952,782 (GRCm39) T154A probably benign Het
Filip1 G T 9: 79,727,757 (GRCm39) Y287* probably null Het
Flt3 T C 5: 147,284,864 (GRCm39) D751G probably damaging Het
Frem1 T A 4: 82,918,226 (GRCm39) Q572L probably benign Het
Gja10 G A 4: 32,602,441 (GRCm39) probably benign Het
Gm39115 A G 7: 141,689,360 (GRCm39) C138R unknown Het
Gm7356 T A 17: 14,221,699 (GRCm39) Y110F probably benign Het
Igf2r T C 17: 12,952,747 (GRCm39) K233R probably benign Het
Igkv9-129 A T 6: 67,817,206 (GRCm39) E103D probably benign Het
Igsf11 C A 16: 38,827,586 (GRCm39) T48N probably damaging Het
Itpkc A T 7: 26,913,944 (GRCm39) Y506N probably damaging Het
Kat2a A C 11: 100,600,304 (GRCm39) M357R possibly damaging Het
Kbtbd12 T C 6: 88,595,132 (GRCm39) R233G possibly damaging Het
Kcnd2 T A 6: 21,726,197 (GRCm39) C563* probably null Het
Kcnu1 T C 8: 26,382,018 (GRCm39) V456A probably benign Het
Kif24 A G 4: 41,428,825 (GRCm39) V45A probably damaging Het
Macf1 A T 4: 123,289,414 (GRCm39) probably benign Het
Map3k19 T A 1: 127,745,007 (GRCm39) E1177D Het
Mdn1 G T 4: 32,725,107 (GRCm39) L2575F probably benign Het
Mga T A 2: 119,776,800 (GRCm39) M1569K possibly damaging Het
Mvk T C 5: 114,588,840 (GRCm39) Y161H probably damaging Het
Or10al3 T A 17: 38,012,389 (GRCm39) M276K probably benign Het
Or14c44 G T 7: 86,061,987 (GRCm39) C139F probably damaging Het
Or2n1 C A 17: 38,486,464 (GRCm39) T163K probably damaging Het
Pcdhb14 T A 18: 37,583,075 (GRCm39) V727E possibly damaging Het
Pcsk7 T G 9: 45,821,707 (GRCm39) V167G probably damaging Het
Plin5 T C 17: 56,422,221 (GRCm39) D146G probably benign Het
Plxna4 C T 6: 32,188,000 (GRCm39) G879R possibly damaging Het
Prss58 C T 6: 40,872,594 (GRCm39) A171T probably benign Het
Pum1 A G 4: 130,499,231 (GRCm39) I1016V probably benign Het
Rbm43 A G 2: 51,816,712 (GRCm39) V85A probably damaging Het
Rdh16f2 T A 10: 127,712,864 (GRCm39) D287E probably damaging Het
Rptor T A 11: 119,702,812 (GRCm39) L393Q probably damaging Het
Sbf2 T G 7: 109,970,825 (GRCm39) H857P possibly damaging Het
Scn8a A C 15: 100,938,387 (GRCm39) T1919P probably benign Het
Sema6b C T 17: 56,434,084 (GRCm39) G377E probably damaging Het
Senp7 T A 16: 55,975,603 (GRCm39) D436E probably damaging Het
Slc6a17 T A 3: 107,380,901 (GRCm39) I535F probably benign Het
Sptbn2 T A 19: 4,779,158 (GRCm39) S281T possibly damaging Het
Stt3b T C 9: 115,083,999 (GRCm39) I392M probably damaging Het
Tfap2b T C 1: 19,296,660 (GRCm39) V201A possibly damaging Het
Timm10b T C 7: 105,289,876 (GRCm39) probably benign Het
Ttc23 A C 7: 67,312,135 (GRCm39) D14A probably damaging Het
Vgll4 G T 6: 114,867,613 (GRCm39) H79Q probably damaging Het
Vps13d A G 4: 144,818,858 (GRCm39) I3047T Het
Zan T C 5: 137,448,813 (GRCm39) E1680G unknown Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84,885,252 (GRCm39) missense probably damaging 1.00
IGL00701:Usp32 APN 11 84,949,951 (GRCm39) splice site probably null
IGL00848:Usp32 APN 11 84,942,007 (GRCm39) splice site probably benign
IGL00934:Usp32 APN 11 84,897,902 (GRCm39) missense probably damaging 1.00
IGL01019:Usp32 APN 11 84,930,091 (GRCm39) missense probably damaging 0.97
IGL01302:Usp32 APN 11 84,879,308 (GRCm39) missense probably benign 0.05
IGL01444:Usp32 APN 11 84,949,990 (GRCm39) missense probably damaging 0.97
IGL01575:Usp32 APN 11 84,913,628 (GRCm39) missense probably damaging 1.00
IGL01981:Usp32 APN 11 84,927,350 (GRCm39) missense probably benign 0.02
IGL02118:Usp32 APN 11 84,923,003 (GRCm39) nonsense probably null
IGL02159:Usp32 APN 11 84,896,628 (GRCm39) splice site probably null
IGL02227:Usp32 APN 11 84,877,307 (GRCm39) missense probably damaging 1.00
IGL02363:Usp32 APN 11 84,935,613 (GRCm39) missense probably benign 0.01
IGL02524:Usp32 APN 11 84,900,837 (GRCm39) nonsense probably null
IGL02613:Usp32 APN 11 84,930,896 (GRCm39) missense probably damaging 0.99
IGL02720:Usp32 APN 11 84,897,817 (GRCm39) critical splice donor site probably null
IGL02738:Usp32 APN 11 84,974,632 (GRCm39) missense probably damaging 1.00
IGL02929:Usp32 APN 11 84,879,198 (GRCm39) missense probably benign 0.01
IGL03303:Usp32 APN 11 84,913,658 (GRCm39) missense probably damaging 1.00
BB010:Usp32 UTSW 11 84,897,885 (GRCm39) missense probably damaging 1.00
BB020:Usp32 UTSW 11 84,897,885 (GRCm39) missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 84,900,900 (GRCm39) missense probably damaging 1.00
R0026:Usp32 UTSW 11 84,922,900 (GRCm39) missense possibly damaging 0.48
R0295:Usp32 UTSW 11 84,944,518 (GRCm39) missense probably damaging 0.98
R1320:Usp32 UTSW 11 84,908,619 (GRCm39) missense probably damaging 0.98
R1712:Usp32 UTSW 11 84,933,406 (GRCm39) missense probably benign 0.12
R1922:Usp32 UTSW 11 84,897,830 (GRCm39) nonsense probably null
R1973:Usp32 UTSW 11 84,994,757 (GRCm39) missense probably benign 0.09
R2010:Usp32 UTSW 11 84,930,830 (GRCm39) missense probably damaging 0.98
R2082:Usp32 UTSW 11 84,921,338 (GRCm39) missense probably damaging 0.99
R2355:Usp32 UTSW 11 84,896,735 (GRCm39) missense probably benign 0.34
R3147:Usp32 UTSW 11 84,919,913 (GRCm39) missense probably damaging 1.00
R3160:Usp32 UTSW 11 84,916,362 (GRCm39) missense probably damaging 0.97
R3162:Usp32 UTSW 11 84,916,362 (GRCm39) missense probably damaging 0.97
R3716:Usp32 UTSW 11 84,933,389 (GRCm39) missense probably damaging 1.00
R3816:Usp32 UTSW 11 84,885,210 (GRCm39) critical splice donor site probably null
R3870:Usp32 UTSW 11 84,897,881 (GRCm39) nonsense probably null
R3871:Usp32 UTSW 11 84,971,982 (GRCm39) missense probably null 0.81
R4041:Usp32 UTSW 11 84,908,565 (GRCm39) missense probably benign 0.40
R4079:Usp32 UTSW 11 84,930,055 (GRCm39) missense probably damaging 0.98
R4332:Usp32 UTSW 11 84,994,804 (GRCm39) missense possibly damaging 0.79
R4396:Usp32 UTSW 11 84,944,801 (GRCm39) missense probably benign
R4580:Usp32 UTSW 11 84,949,953 (GRCm39) critical splice donor site probably null
R4620:Usp32 UTSW 11 84,949,953 (GRCm39) critical splice donor site probably null
R4744:Usp32 UTSW 11 84,885,219 (GRCm39) missense probably damaging 1.00
R4909:Usp32 UTSW 11 84,946,598 (GRCm39) nonsense probably null
R5056:Usp32 UTSW 11 84,917,621 (GRCm39) missense probably benign 0.07
R5111:Usp32 UTSW 11 84,968,157 (GRCm39) missense possibly damaging 0.95
R5213:Usp32 UTSW 11 84,913,085 (GRCm39) missense probably damaging 1.00
R5308:Usp32 UTSW 11 84,908,544 (GRCm39) missense probably benign 0.12
R5381:Usp32 UTSW 11 84,949,953 (GRCm39) critical splice donor site probably benign
R5538:Usp32 UTSW 11 84,908,612 (GRCm39) missense possibly damaging 0.65
R5659:Usp32 UTSW 11 84,968,240 (GRCm39) missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84,883,277 (GRCm39) critical splice donor site probably null
R6011:Usp32 UTSW 11 84,922,923 (GRCm39) missense possibly damaging 0.70
R6029:Usp32 UTSW 11 84,916,408 (GRCm39) missense probably damaging 0.99
R6074:Usp32 UTSW 11 84,885,399 (GRCm39) missense probably benign 0.00
R6331:Usp32 UTSW 11 84,877,402 (GRCm39) missense possibly damaging 0.92
R6353:Usp32 UTSW 11 84,913,107 (GRCm39) missense probably benign
R6714:Usp32 UTSW 11 84,917,696 (GRCm39) missense probably damaging 0.99
R6778:Usp32 UTSW 11 84,916,512 (GRCm39) missense probably benign 0.00
R6988:Usp32 UTSW 11 84,900,969 (GRCm39) missense probably benign 0.35
R6992:Usp32 UTSW 11 84,922,914 (GRCm39) missense probably damaging 0.99
R7182:Usp32 UTSW 11 84,930,996 (GRCm39) missense probably benign 0.34
R7186:Usp32 UTSW 11 84,942,060 (GRCm39) missense probably benign 0.45
R7198:Usp32 UTSW 11 84,913,681 (GRCm39) frame shift probably null
R7201:Usp32 UTSW 11 84,913,681 (GRCm39) frame shift probably null
R7469:Usp32 UTSW 11 84,879,379 (GRCm39) missense possibly damaging 0.94
R7502:Usp32 UTSW 11 84,913,724 (GRCm39) missense possibly damaging 0.48
R7513:Usp32 UTSW 11 84,917,938 (GRCm39) nonsense probably null
R7629:Usp32 UTSW 11 84,910,681 (GRCm39) frame shift probably null
R7703:Usp32 UTSW 11 84,968,153 (GRCm39) missense probably damaging 0.99
R7741:Usp32 UTSW 11 84,878,107 (GRCm39) missense probably damaging 0.99
R7765:Usp32 UTSW 11 84,885,234 (GRCm39) missense probably damaging 1.00
R7933:Usp32 UTSW 11 84,897,885 (GRCm39) missense probably damaging 1.00
R7973:Usp32 UTSW 11 84,913,634 (GRCm39) missense probably damaging 0.99
R7989:Usp32 UTSW 11 84,925,126 (GRCm39) missense
R7998:Usp32 UTSW 11 84,885,252 (GRCm39) missense probably damaging 1.00
R8292:Usp32 UTSW 11 84,968,227 (GRCm39) missense probably damaging 0.99
R8548:Usp32 UTSW 11 84,908,653 (GRCm39) missense possibly damaging 0.52
R8924:Usp32 UTSW 11 84,916,370 (GRCm39) missense probably damaging 0.98
R9002:Usp32 UTSW 11 84,944,777 (GRCm39) missense probably damaging 0.96
R9145:Usp32 UTSW 11 84,913,118 (GRCm39) missense probably damaging 1.00
R9209:Usp32 UTSW 11 84,930,838 (GRCm39) missense probably damaging 0.98
R9211:Usp32 UTSW 11 84,913,559 (GRCm39) missense probably damaging 1.00
R9296:Usp32 UTSW 11 84,908,478 (GRCm39) missense probably damaging 1.00
R9310:Usp32 UTSW 11 84,942,028 (GRCm39) missense probably benign 0.29
R9417:Usp32 UTSW 11 84,885,369 (GRCm39) missense probably damaging 1.00
R9514:Usp32 UTSW 11 84,913,560 (GRCm39) missense probably damaging 0.99
R9652:Usp32 UTSW 11 84,921,317 (GRCm39) missense probably damaging 0.97
R9723:Usp32 UTSW 11 84,935,536 (GRCm39) nonsense probably null
R9757:Usp32 UTSW 11 84,968,155 (GRCm39) nonsense probably null
X0028:Usp32 UTSW 11 84,883,432 (GRCm39) missense probably benign 0.05
Z1177:Usp32 UTSW 11 84,879,438 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGGCCTATATTCCCAGCAG -3'
(R):5'- TGCCGCCCATCTATGTTCAAG -3'

Sequencing Primer
(F):5'- GGCCTATATTCCCAGCAGGATTTAAC -3'
(R):5'- CGCCCATCTATGTTCAAGTTTTTC -3'
Posted On 2020-07-28