Incidental Mutation 'R8305:Scn8a'
ID 641025
Institutional Source Beutler Lab
Gene Symbol Scn8a
Ensembl Gene ENSMUSG00000023033
Gene Name sodium channel, voltage-gated, type VIII, alpha
Synonyms mnd2, C630029C19Rik, nmf58, NMF335, mnd-2, seal, motor end-plate disease, nur14, Nav1.6, med, ataxia 3, nmf2, nmf335, NaCh6
MMRRC Submission
Accession Numbers

Genbank: NM_001077499, NM_011323; MGI: 103169

Is this an essential gene? Probably essential (E-score: 0.775) question?
Stock # R8305 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 100869858-101045938 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 101040506 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 1919 (T1919P)
Ref Sequence ENSEMBL: ENSMUSP00000104538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082209] [ENSMUST00000108908] [ENSMUST00000108909] [ENSMUST00000108910] [ENSMUST00000200963] [ENSMUST00000201549]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000082209
AA Change: T1919P

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000080842
Gene: ENSMUSG00000023033
AA Change: T1919P

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 7.4e-82 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 3.5e-72 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 2.2e-57 PFAM
Pfam:Na_trans_assoc 989 1191 2e-59 PFAM
Pfam:Ion_trans 1195 1472 6.2e-69 PFAM
Pfam:Ion_trans 1519 1775 1.2e-56 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108908
AA Change: T1919P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000104536
Gene: ENSMUSG00000023033
AA Change: T1919P

DomainStartEndE-ValueType
Pfam:Ion_trans 72 322 1.9e-76 PFAM
low complexity region 367 378 N/A INTRINSIC
Pfam:Ion_trans 451 640 1.1e-47 PFAM
Pfam:Na_trans_assoc 655 872 1.9e-71 PFAM
Pfam:Ion_trans 898 1127 4.4e-59 PFAM
PDB:1BYY|A 1129 1181 7e-30 PDB
Pfam:Ion_trans 1220 1429 1.9e-51 PFAM
Pfam:PKD_channel 1281 1436 5.6e-7 PFAM
IQ 1558 1580 1.2e-4 SMART
low complexity region 1619 1638 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000108909
AA Change: T1929P
SMART Domains Protein: ENSMUSP00000104537
Gene: ENSMUSG00000023033
AA Change: T1929P

DomainStartEndE-ValueType
Pfam:Ion_trans 72 322 2.2e-76 PFAM
low complexity region 335 364 N/A INTRINSIC
Pfam:DUF3451 390 616 8.7e-70 PFAM
Pfam:Ion_trans 697 886 1.3e-47 PFAM
Pfam:Na_trans_assoc 901 1118 2.3e-71 PFAM
Pfam:Ion_trans 1144 1186 9.7e-10 PFAM
Pfam:Ion_trans 1182 1332 1.7e-31 PFAM
PDB:1BYY|A 1334 1386 2e-29 PDB
Pfam:Ion_trans 1425 1634 2.3e-51 PFAM
Pfam:PKD_channel 1486 1641 6.6e-7 PFAM
IQ 1763 1785 1.2e-4 SMART
low complexity region 1824 1843 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108910
AA Change: T1919P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000104538
Gene: ENSMUSG00000023033
AA Change: T1919P

DomainStartEndE-ValueType
Pfam:Ion_trans 160 410 2.5e-76 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:DUF3451 478 704 9.6e-70 PFAM
Pfam:Ion_trans 785 974 1.4e-47 PFAM
Pfam:Na_trans_assoc 989 1206 2.5e-71 PFAM
Pfam:Ion_trans 1232 1461 5.7e-59 PFAM
PDB:1BYY|A 1463 1515 4e-29 PDB
Pfam:Ion_trans 1554 1763 2.5e-51 PFAM
Pfam:PKD_channel 1615 1770 7.1e-7 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200963
AA Change: T1878P

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000144371
Gene: ENSMUSG00000023033
AA Change: T1878P

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 4.1e-80 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 2.5e-69 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 1.2e-55 PFAM
Pfam:Na_trans_assoc 989 1191 9.1e-57 PFAM
Pfam:Ion_trans 1195 1274 7.6e-16 PFAM
Pfam:Ion_trans 1270 1431 2.6e-33 PFAM
Pfam:Ion_trans 1478 1734 6.5e-55 PFAM
IQ 1851 1873 6e-7 SMART
low complexity region 1912 1931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201549
AA Change: T1919P

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000144013
Gene: ENSMUSG00000023033
AA Change: T1919P

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 7.4e-82 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 3.5e-72 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 2.2e-57 PFAM
Pfam:Na_trans_assoc 989 1191 2e-59 PFAM
Pfam:Ion_trans 1195 1472 6.2e-69 PFAM
Pfam:Ion_trans 1519 1775 1.2e-56 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium channel alpha subunit gene family. The encoded protein forms the ion pore region of the voltage-gated sodium channel. This protein is essential for the rapid membrane depolarization that occurs during the formation of the action potential in excitable neurons. Mutations in this gene are associated with mental retardation, pancerebellar atrophy and ataxia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Spontaneous mutant homozygotes have ataxia, dystonia, muscular atrophy, progressive paralysis, Purkinje cell loss, in some cases severe head-tossing and for severe alleles, juvenile lethality. A mild, semidominant ENU allele causes deafness of variable penetrance and severity and mild tremor. [provided by MGI curators]
Allele List at MGI

 All alleles(22) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(6) Transgenic(1) Spontaneous(5) Chemically induced(8)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,971,395 E243K possibly damaging Het
Accsl A T 2: 93,866,078 H58Q probably benign Het
Actl7a T A 4: 56,743,744 F90L probably benign Het
Adam5 G A 8: 24,810,703 A270V possibly damaging Het
Angptl3 A G 4: 99,031,311 T103A probably damaging Het
Ankhd1 T C 18: 36,647,166 L1757P possibly damaging Het
Apoa4 T A 9: 46,241,155 M1K probably null Het
Arih1 T A 9: 59,396,487 Q445L probably benign Het
Asb14 A T 14: 26,912,097 I420L probably benign Het
Bbs2 A C 8: 94,074,325 V626G probably damaging Het
BC089597 T A 10: 127,876,995 D287E probably damaging Het
Cep290 C A 10: 100,544,934 A1678D probably benign Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Clca3a1 C T 3: 144,759,166 probably benign Het
Clca3b T A 3: 144,825,937 N702I probably damaging Het
Col24a1 T C 3: 145,474,182 V1143A probably benign Het
Cux1 T C 5: 136,360,009 T223A probably benign Het
Defa30 A T 8: 21,135,459 T80S probably benign Het
Dennd1a G A 2: 37,858,081 L375F probably damaging Het
Dnajc6 C T 4: 101,623,787 T675I probably damaging Het
Emc9 A G 14: 55,585,099 V4A probably damaging Het
Enpp3 C G 10: 24,824,929 probably null Het
Fam117b A G 1: 59,913,623 T154A probably benign Het
Filip1 G T 9: 79,820,475 Y287* probably null Het
Flt3 T C 5: 147,348,054 D751G probably damaging Het
Frem1 T A 4: 82,999,989 Q572L probably benign Het
Gja10 G A 4: 32,602,441 probably benign Het
Gm7356 T A 17: 14,001,437 Y110F probably benign Het
Igf2r T C 17: 12,733,860 K233R probably benign Het
Igkv9-129 A T 6: 67,840,222 E103D probably benign Het
Igsf11 C A 16: 39,007,224 T48N probably damaging Het
Itpkc A T 7: 27,214,519 Y506N probably damaging Het
Kat2a A C 11: 100,709,478 M357R possibly damaging Het
Kbtbd12 T C 6: 88,618,150 R233G possibly damaging Het
Kcnd2 T A 6: 21,726,198 C563* probably null Het
Kcnu1 T C 8: 25,891,990 V456A probably benign Het
Kif24 A G 4: 41,428,825 V45A probably damaging Het
Macf1 A T 4: 123,395,621 probably benign Het
Map3k19 T A 1: 127,817,270 E1177D Het
Mdn1 G T 4: 32,725,107 L2575F probably benign Het
Mga T A 2: 119,946,319 M1569K possibly damaging Het
Mvk T C 5: 114,450,779 Y161H probably damaging Het
Olfr119 T A 17: 37,701,498 M276K probably benign Het
Olfr134 C A 17: 38,175,573 T163K probably damaging Het
Olfr301 G T 7: 86,412,779 C139F probably damaging Het
Pcdhb14 T A 18: 37,450,022 V727E possibly damaging Het
Pcsk7 T G 9: 45,910,409 V167G probably damaging Het
Plin5 T C 17: 56,115,221 D146G probably benign Het
Plxna4 C T 6: 32,211,065 G879R possibly damaging Het
Prss58 C T 6: 40,895,660 A171T probably benign Het
Pum1 A G 4: 130,771,920 I1016V probably benign Het
Rbm43 A G 2: 51,926,700 V85A probably damaging Het
RP23-56A14.9 A G 7: 142,135,623 C138R unknown Het
Rptor T A 11: 119,811,986 L393Q probably damaging Het
Sbf2 T G 7: 110,371,618 H857P possibly damaging Het
Sema6b C T 17: 56,127,084 G377E probably damaging Het
Senp7 T A 16: 56,155,240 D436E probably damaging Het
Slc6a17 T A 3: 107,473,585 I535F probably benign Het
Sptbn2 T A 19: 4,729,130 S281T possibly damaging Het
Stt3b T C 9: 115,254,931 I392M probably damaging Het
Tfap2b T C 1: 19,226,436 V201A possibly damaging Het
Timm10b T C 7: 105,640,669 probably benign Het
Ttc23 A C 7: 67,662,387 D14A probably damaging Het
Usp32 A T 11: 85,032,185 L636I possibly damaging Het
Vgll4 G T 6: 114,890,652 H79Q probably damaging Het
Vps13d A G 4: 145,092,288 I3047T Het
Zan T C 5: 137,450,551 E1680G unknown Het
Other mutations in Scn8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Scn8a APN 15 100955532 unclassified probably benign
IGL00979:Scn8a APN 15 100955406 unclassified probably benign
IGL01339:Scn8a APN 15 101032201 missense probably benign
IGL01992:Scn8a APN 15 100969057 missense probably damaging 1.00
IGL02215:Scn8a APN 15 101029572 splice site probably null
IGL02311:Scn8a APN 15 101013283 missense probably damaging 0.97
IGL02404:Scn8a APN 15 101039730 missense probably damaging 1.00
IGL02652:Scn8a APN 15 101013476 missense probably damaging 0.98
IGL02690:Scn8a APN 15 100970254 missense probably damaging 1.00
IGL02704:Scn8a APN 15 101008062 missense possibly damaging 0.94
IGL03084:Scn8a APN 15 101017172 missense probably damaging 1.00
IGL03108:Scn8a APN 15 100974615 missense probably benign
IGL03224:Scn8a APN 15 101035639 missense probably damaging 1.00
dan UTSW 15 101035624 nonsense probably null
nymph UTSW 15 101035646 missense probably damaging 1.00
Tremord UTSW 15 101013504 missense probably damaging 1.00
3-1:Scn8a UTSW 15 101039939 missense probably benign 0.04
PIT4280001:Scn8a UTSW 15 100957489 missense probably damaging 1.00
PIT4508001:Scn8a UTSW 15 101029692 missense probably damaging 0.98
R0010:Scn8a UTSW 15 101013573 missense probably damaging 1.00
R0010:Scn8a UTSW 15 101013573 missense probably damaging 1.00
R0254:Scn8a UTSW 15 101018364 missense probably damaging 1.00
R0412:Scn8a UTSW 15 101008306 splice site probably benign
R0538:Scn8a UTSW 15 101035624 nonsense probably null
R0539:Scn8a UTSW 15 101016568 missense probably damaging 1.00
R0631:Scn8a UTSW 15 101035537 missense probably damaging 1.00
R0726:Scn8a UTSW 15 100972830 missense probably damaging 1.00
R0945:Scn8a UTSW 15 101015787 missense possibly damaging 0.54
R0967:Scn8a UTSW 15 101035646 missense probably damaging 1.00
R1164:Scn8a UTSW 15 101040162 missense probably benign 0.06
R1283:Scn8a UTSW 15 100969171 missense possibly damaging 0.82
R1368:Scn8a UTSW 15 101035541 missense probably damaging 1.00
R1633:Scn8a UTSW 15 101029815 missense probably benign 0.01
R1669:Scn8a UTSW 15 101011120 missense probably damaging 1.00
R1694:Scn8a UTSW 15 100955528 nonsense probably null
R1735:Scn8a UTSW 15 101015861 missense possibly damaging 0.94
R1773:Scn8a UTSW 15 101039615 missense probably damaging 0.97
R1940:Scn8a UTSW 15 100970204 missense probably benign 0.22
R1996:Scn8a UTSW 15 101024379 missense probably damaging 1.00
R2107:Scn8a UTSW 15 101018363 missense probably damaging 0.99
R2251:Scn8a UTSW 15 101017106 missense probably benign 0.02
R2516:Scn8a UTSW 15 100969162 missense probably benign 0.05
R2917:Scn8a UTSW 15 101039732 missense probably damaging 1.00
R3417:Scn8a UTSW 15 100971668 splice site probably benign
R3896:Scn8a UTSW 15 101035498 missense probably benign
R4024:Scn8a UTSW 15 101039793 missense probably damaging 1.00
R4050:Scn8a UTSW 15 101013413 nonsense probably null
R4193:Scn8a UTSW 15 100971603 missense probably damaging 1.00
R4212:Scn8a UTSW 15 100957073 missense possibly damaging 0.88
R4358:Scn8a UTSW 15 100940133 missense probably benign 0.00
R4396:Scn8a UTSW 15 100972830 missense probably damaging 1.00
R4428:Scn8a UTSW 15 100983903 missense probably damaging 1.00
R4452:Scn8a UTSW 15 100957091 missense possibly damaging 0.95
R4631:Scn8a UTSW 15 101016503 nonsense probably null
R4693:Scn8a UTSW 15 101015691 missense probably damaging 1.00
R4765:Scn8a UTSW 15 101040471 missense probably benign 0.07
R4777:Scn8a UTSW 15 101015951 missense probably damaging 1.00
R4949:Scn8a UTSW 15 101029782 missense probably damaging 1.00
R4997:Scn8a UTSW 15 100957054 missense probably damaging 1.00
R5246:Scn8a UTSW 15 101011057 missense probably damaging 1.00
R5566:Scn8a UTSW 15 100974534 missense probably damaging 1.00
R5875:Scn8a UTSW 15 100972822 nonsense probably null
R6031:Scn8a UTSW 15 100983984 missense probably damaging 1.00
R6031:Scn8a UTSW 15 100983984 missense probably damaging 1.00
R6057:Scn8a UTSW 15 100974667 missense possibly damaging 0.94
R6114:Scn8a UTSW 15 101040596 missense probably damaging 0.99
R6362:Scn8a UTSW 15 100940115 splice site probably null
R6535:Scn8a UTSW 15 100959707 intron probably benign
R6677:Scn8a UTSW 15 100969072 missense probably damaging 1.00
R6687:Scn8a UTSW 15 100974627 missense probably benign 0.12
R6701:Scn8a UTSW 15 101040096 missense probably damaging 1.00
R6719:Scn8a UTSW 15 101011015 critical splice acceptor site probably null
R6739:Scn8a UTSW 15 101015955 missense possibly damaging 0.82
R6769:Scn8a UTSW 15 101035564 missense probably benign
R6786:Scn8a UTSW 15 101032215 missense probably benign 0.00
R6849:Scn8a UTSW 15 100955587 splice site probably null
R7108:Scn8a UTSW 15 101039778 missense probably benign 0.01
R7215:Scn8a UTSW 15 101029830 missense possibly damaging 0.80
R7217:Scn8a UTSW 15 100970227 missense probably benign 0.00
R7219:Scn8a UTSW 15 100969103 missense probably damaging 1.00
R7356:Scn8a UTSW 15 100957579 missense probably damaging 1.00
R7479:Scn8a UTSW 15 100955477 missense probably damaging 0.99
R7816:Scn8a UTSW 15 101011036 missense possibly damaging 0.63
R7985:Scn8a UTSW 15 101016962 splice site probably null
R8112:Scn8a UTSW 15 101029837 missense probably benign 0.27
R8263:Scn8a UTSW 15 100983855 missense probably damaging 1.00
R8489:Scn8a UTSW 15 100969133 missense probably damaging 1.00
R8983:Scn8a UTSW 15 101002149 missense possibly damaging 0.81
R9034:Scn8a UTSW 15 101029761 missense probably damaging 0.98
R9050:Scn8a UTSW 15 101008280 missense possibly damaging 0.80
R9240:Scn8a UTSW 15 101017187 nonsense probably null
R9249:Scn8a UTSW 15 101016575 missense probably benign 0.00
R9462:Scn8a UTSW 15 101032278 missense
R9599:Scn8a UTSW 15 101013291 missense probably damaging 1.00
R9609:Scn8a UTSW 15 100936526 missense possibly damaging 0.91
R9653:Scn8a UTSW 15 101040066 missense probably damaging 1.00
R9794:Scn8a UTSW 15 101035451 missense probably benign 0.00
X0066:Scn8a UTSW 15 101040080 missense probably damaging 1.00
X0066:Scn8a UTSW 15 101040081 missense probably damaging 1.00
Z1176:Scn8a UTSW 15 101033518 missense probably damaging 1.00
Z1177:Scn8a UTSW 15 101040222 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCGCCTTCACCAAGCGAG -3'
(R):5'- TCTAGCACTTGGACTCCCTG -3'

Sequencing Primer
(F):5'- TTCACCAAGCGAGTCCTGG -3'
(R):5'- AGCACTTGGACTCCCTGACTTC -3'
Posted On 2020-07-28