Incidental Mutation 'R8305:Olfr119'
ID 641030
Institutional Source Beutler Lab
Gene Symbol Olfr119
Ensembl Gene ENSMUSG00000059964
Gene Name olfactory receptor 119
Synonyms MOR263-7, GA_x6K02T2PSCP-2159633-2160598
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R8305 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 37696564-37702124 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37701498 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 276 (M276K)
Ref Sequence ENSEMBL: ENSMUSP00000092919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080483]
AlphaFold Q7TRJ5
Predicted Effect probably benign
Transcript: ENSMUST00000080483
AA Change: M276K

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000092919
Gene: ENSMUSG00000059964
AA Change: M276K

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 5.6e-59 PFAM
Pfam:7TM_GPCR_Srsx 41 311 1.7e-5 PFAM
Pfam:7tm_1 47 296 3.1e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,971,395 E243K possibly damaging Het
Accsl A T 2: 93,866,078 H58Q probably benign Het
Actl7a T A 4: 56,743,744 F90L probably benign Het
Adam5 G A 8: 24,810,703 A270V possibly damaging Het
Angptl3 A G 4: 99,031,311 T103A probably damaging Het
Ankhd1 T C 18: 36,647,166 L1757P possibly damaging Het
Apoa4 T A 9: 46,241,155 M1K probably null Het
Arih1 T A 9: 59,396,487 Q445L probably benign Het
Asb14 A T 14: 26,912,097 I420L probably benign Het
Bbs2 A C 8: 94,074,325 V626G probably damaging Het
BC089597 T A 10: 127,876,995 D287E probably damaging Het
Cep290 C A 10: 100,544,934 A1678D probably benign Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Clca3a1 C T 3: 144,759,166 probably benign Het
Clca3b T A 3: 144,825,937 N702I probably damaging Het
Col24a1 T C 3: 145,474,182 V1143A probably benign Het
Cux1 T C 5: 136,360,009 T223A probably benign Het
Defa30 A T 8: 21,135,459 T80S probably benign Het
Dennd1a G A 2: 37,858,081 L375F probably damaging Het
Dnajc6 C T 4: 101,623,787 T675I probably damaging Het
Emc9 A G 14: 55,585,099 V4A probably damaging Het
Enpp3 C G 10: 24,824,929 probably null Het
Fam117b A G 1: 59,913,623 T154A probably benign Het
Filip1 G T 9: 79,820,475 Y287* probably null Het
Flt3 T C 5: 147,348,054 D751G probably damaging Het
Frem1 T A 4: 82,999,989 Q572L probably benign Het
Gja10 G A 4: 32,602,441 probably benign Het
Gm7356 T A 17: 14,001,437 Y110F probably benign Het
Igf2r T C 17: 12,733,860 K233R probably benign Het
Igkv9-129 A T 6: 67,840,222 E103D probably benign Het
Igsf11 C A 16: 39,007,224 T48N probably damaging Het
Itpkc A T 7: 27,214,519 Y506N probably damaging Het
Kat2a A C 11: 100,709,478 M357R possibly damaging Het
Kbtbd12 T C 6: 88,618,150 R233G possibly damaging Het
Kcnd2 T A 6: 21,726,198 C563* probably null Het
Kcnu1 T C 8: 25,891,990 V456A probably benign Het
Kif24 A G 4: 41,428,825 V45A probably damaging Het
Macf1 A T 4: 123,395,621 probably benign Het
Map3k19 T A 1: 127,817,270 E1177D Het
Mdn1 G T 4: 32,725,107 L2575F probably benign Het
Mga T A 2: 119,946,319 M1569K possibly damaging Het
Mvk T C 5: 114,450,779 Y161H probably damaging Het
Olfr134 C A 17: 38,175,573 T163K probably damaging Het
Olfr301 G T 7: 86,412,779 C139F probably damaging Het
Pcdhb14 T A 18: 37,450,022 V727E possibly damaging Het
Pcsk7 T G 9: 45,910,409 V167G probably damaging Het
Plin5 T C 17: 56,115,221 D146G probably benign Het
Plxna4 C T 6: 32,211,065 G879R possibly damaging Het
Prss58 C T 6: 40,895,660 A171T probably benign Het
Pum1 A G 4: 130,771,920 I1016V probably benign Het
Rbm43 A G 2: 51,926,700 V85A probably damaging Het
RP23-56A14.9 A G 7: 142,135,623 C138R unknown Het
Rptor T A 11: 119,811,986 L393Q probably damaging Het
Sbf2 T G 7: 110,371,618 H857P possibly damaging Het
Scn8a A C 15: 101,040,506 T1919P probably benign Het
Sema6b C T 17: 56,127,084 G377E probably damaging Het
Senp7 T A 16: 56,155,240 D436E probably damaging Het
Slc6a17 T A 3: 107,473,585 I535F probably benign Het
Sptbn2 T A 19: 4,729,130 S281T possibly damaging Het
Stt3b T C 9: 115,254,931 I392M probably damaging Het
Tfap2b T C 1: 19,226,436 V201A possibly damaging Het
Timm10b T C 7: 105,640,669 probably benign Het
Ttc23 A C 7: 67,662,387 D14A probably damaging Het
Usp32 A T 11: 85,032,185 L636I possibly damaging Het
Vgll4 G T 6: 114,890,652 H79Q probably damaging Het
Vps13d A G 4: 145,092,288 I3047T Het
Zan T C 5: 137,450,551 E1680G unknown Het
Other mutations in Olfr119
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02209:Olfr119 APN 17 37700992 missense probably damaging 1.00
IGL03339:Olfr119 APN 17 37700791 missense probably damaging 0.99
R0092:Olfr119 UTSW 17 37700805 missense probably damaging 0.98
R0207:Olfr119 UTSW 17 37701058 nonsense probably null
R0378:Olfr119 UTSW 17 37701041 missense probably damaging 1.00
R0408:Olfr119 UTSW 17 37701299 missense probably benign
R0483:Olfr119 UTSW 17 37701297 missense probably benign 0.01
R1595:Olfr119 UTSW 17 37701113 missense probably benign 0.03
R1901:Olfr119 UTSW 17 37701421 missense probably damaging 1.00
R1902:Olfr119 UTSW 17 37701421 missense probably damaging 1.00
R2845:Olfr119 UTSW 17 37700823 missense probably damaging 1.00
R2846:Olfr119 UTSW 17 37700823 missense probably damaging 1.00
R4356:Olfr119 UTSW 17 37700899 missense probably damaging 0.97
R4381:Olfr119 UTSW 17 37700899 missense probably damaging 0.97
R6744:Olfr119 UTSW 17 37701445 nonsense probably null
R7674:Olfr119 UTSW 17 37700682 missense probably benign 0.03
R7677:Olfr119 UTSW 17 37701066 missense probably damaging 1.00
R7994:Olfr119 UTSW 17 37701435 missense probably damaging 0.99
R8512:Olfr119 UTSW 17 37701180 missense probably damaging 1.00
R9300:Olfr119 UTSW 17 37700924 missense probably damaging 1.00
R9760:Olfr119 UTSW 17 37701543 missense probably damaging 1.00
Z1177:Olfr119 UTSW 17 37701053 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGATACATCCCAAAATGAGGCTGC -3'
(R):5'- CTCATTACCCAGCAGCTCTG -3'

Sequencing Primer
(F):5'- CCAAAATGAGGCTGCAATTTTTGTGG -3'
(R):5'- AGCTCTGCAAGGTTCTGTTAC -3'
Posted On 2020-07-28