Incidental Mutation 'R8305:Plin5'
ID 641032
Institutional Source Beutler Lab
Gene Symbol Plin5
Ensembl Gene ENSMUSG00000011305
Gene Name perilipin 5
Synonyms Lsdp5, MLDP, 2310076L09Rik
MMRRC Submission 067716-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.138) question?
Stock # R8305 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 56418601-56424596 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 56422221 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 146 (D146G)
Ref Sequence ENSEMBL: ENSMUSP00000019808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019808] [ENSMUST00000041357] [ENSMUST00000113072]
AlphaFold Q8BVZ1
Predicted Effect probably benign
Transcript: ENSMUST00000019808
AA Change: D146G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000019808
Gene: ENSMUSG00000011305
AA Change: D146G

DomainStartEndE-ValueType
Pfam:Perilipin 31 383 1.2e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041357
SMART Domains Protein: ENSMUSP00000038048
Gene: ENSMUSG00000037095

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LRR 84 107 1.86e0 SMART
LRR_TYP 108 131 3.63e-3 SMART
LRR 133 155 5.89e1 SMART
LRR_TYP 156 179 1.45e-2 SMART
LRR_TYP 180 203 8.47e-4 SMART
LRR 205 227 2.08e1 SMART
LRR 229 251 1.91e1 SMART
LRR 252 275 5.34e-1 SMART
LRRCT 292 342 9.69e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113072
AA Change: D146G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000108695
Gene: ENSMUSG00000011305
AA Change: D146G

DomainStartEndE-ValueType
Pfam:Perilipin 27 384 2.3e-128 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the perilipin family, such as PLIN5, coat intracellular lipid storage droplets and protect them from lipolytic degradation (Dalen et al., 2007 [PubMed 17234449]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit excessive fatty acid oxidation, abnormal lipid levels in organs depending on fed or fasted state, increased oxygen consumption and activity in the dark phase, and decreased cardiac muscle contractility in aged mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 64,208,844 (GRCm39) E243K possibly damaging Het
Accsl A T 2: 93,696,423 (GRCm39) H58Q probably benign Het
Actl7a T A 4: 56,743,744 (GRCm39) F90L probably benign Het
Adam5 G A 8: 25,300,719 (GRCm39) A270V possibly damaging Het
Angptl3 A G 4: 98,919,548 (GRCm39) T103A probably damaging Het
Ankhd1 T C 18: 36,780,219 (GRCm39) L1757P possibly damaging Het
Apoa4 T A 9: 46,152,453 (GRCm39) M1K probably null Het
Arih1 T A 9: 59,303,770 (GRCm39) Q445L probably benign Het
Asb14 A T 14: 26,634,054 (GRCm39) I420L probably benign Het
Bbs2 A C 8: 94,800,953 (GRCm39) V626G probably damaging Het
Cep290 C A 10: 100,380,796 (GRCm39) A1678D probably benign Het
Cilp G A 9: 65,186,286 (GRCm39) G794S probably damaging Het
Clca3a1 C T 3: 144,464,927 (GRCm39) probably benign Het
Clca3b T A 3: 144,531,698 (GRCm39) N702I probably damaging Het
Col24a1 T C 3: 145,179,937 (GRCm39) V1143A probably benign Het
Cux1 T C 5: 136,388,863 (GRCm39) T223A probably benign Het
Defa30 A T 8: 21,625,475 (GRCm39) T80S probably benign Het
Dennd1a G A 2: 37,748,093 (GRCm39) L375F probably damaging Het
Dnajc6 C T 4: 101,480,984 (GRCm39) T675I probably damaging Het
Emc9 A G 14: 55,822,556 (GRCm39) V4A probably damaging Het
Enpp3 C G 10: 24,700,827 (GRCm39) probably null Het
Fam117b A G 1: 59,952,782 (GRCm39) T154A probably benign Het
Filip1 G T 9: 79,727,757 (GRCm39) Y287* probably null Het
Flt3 T C 5: 147,284,864 (GRCm39) D751G probably damaging Het
Frem1 T A 4: 82,918,226 (GRCm39) Q572L probably benign Het
Gja10 G A 4: 32,602,441 (GRCm39) probably benign Het
Gm39115 A G 7: 141,689,360 (GRCm39) C138R unknown Het
Gm7356 T A 17: 14,221,699 (GRCm39) Y110F probably benign Het
Igf2r T C 17: 12,952,747 (GRCm39) K233R probably benign Het
Igkv9-129 A T 6: 67,817,206 (GRCm39) E103D probably benign Het
Igsf11 C A 16: 38,827,586 (GRCm39) T48N probably damaging Het
Itpkc A T 7: 26,913,944 (GRCm39) Y506N probably damaging Het
Kat2a A C 11: 100,600,304 (GRCm39) M357R possibly damaging Het
Kbtbd12 T C 6: 88,595,132 (GRCm39) R233G possibly damaging Het
Kcnd2 T A 6: 21,726,197 (GRCm39) C563* probably null Het
Kcnu1 T C 8: 26,382,018 (GRCm39) V456A probably benign Het
Kif24 A G 4: 41,428,825 (GRCm39) V45A probably damaging Het
Macf1 A T 4: 123,289,414 (GRCm39) probably benign Het
Map3k19 T A 1: 127,745,007 (GRCm39) E1177D Het
Mdn1 G T 4: 32,725,107 (GRCm39) L2575F probably benign Het
Mga T A 2: 119,776,800 (GRCm39) M1569K possibly damaging Het
Mvk T C 5: 114,588,840 (GRCm39) Y161H probably damaging Het
Or10al3 T A 17: 38,012,389 (GRCm39) M276K probably benign Het
Or14c44 G T 7: 86,061,987 (GRCm39) C139F probably damaging Het
Or2n1 C A 17: 38,486,464 (GRCm39) T163K probably damaging Het
Pcdhb14 T A 18: 37,583,075 (GRCm39) V727E possibly damaging Het
Pcsk7 T G 9: 45,821,707 (GRCm39) V167G probably damaging Het
Plxna4 C T 6: 32,188,000 (GRCm39) G879R possibly damaging Het
Prss58 C T 6: 40,872,594 (GRCm39) A171T probably benign Het
Pum1 A G 4: 130,499,231 (GRCm39) I1016V probably benign Het
Rbm43 A G 2: 51,816,712 (GRCm39) V85A probably damaging Het
Rdh16f2 T A 10: 127,712,864 (GRCm39) D287E probably damaging Het
Rptor T A 11: 119,702,812 (GRCm39) L393Q probably damaging Het
Sbf2 T G 7: 109,970,825 (GRCm39) H857P possibly damaging Het
Scn8a A C 15: 100,938,387 (GRCm39) T1919P probably benign Het
Sema6b C T 17: 56,434,084 (GRCm39) G377E probably damaging Het
Senp7 T A 16: 55,975,603 (GRCm39) D436E probably damaging Het
Slc6a17 T A 3: 107,380,901 (GRCm39) I535F probably benign Het
Sptbn2 T A 19: 4,779,158 (GRCm39) S281T possibly damaging Het
Stt3b T C 9: 115,083,999 (GRCm39) I392M probably damaging Het
Tfap2b T C 1: 19,296,660 (GRCm39) V201A possibly damaging Het
Timm10b T C 7: 105,289,876 (GRCm39) probably benign Het
Ttc23 A C 7: 67,312,135 (GRCm39) D14A probably damaging Het
Usp32 A T 11: 84,923,011 (GRCm39) L636I possibly damaging Het
Vgll4 G T 6: 114,867,613 (GRCm39) H79Q probably damaging Het
Vps13d A G 4: 144,818,858 (GRCm39) I3047T Het
Zan T C 5: 137,448,813 (GRCm39) E1680G unknown Het
Other mutations in Plin5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0304:Plin5 UTSW 17 56,422,597 (GRCm39) missense probably damaging 1.00
R0981:Plin5 UTSW 17 56,421,020 (GRCm39) missense probably damaging 1.00
R1966:Plin5 UTSW 17 56,419,186 (GRCm39) missense probably damaging 1.00
R2153:Plin5 UTSW 17 56,423,836 (GRCm39) missense probably benign 0.02
R2368:Plin5 UTSW 17 56,422,588 (GRCm39) missense probably damaging 1.00
R4809:Plin5 UTSW 17 56,423,855 (GRCm39) missense probably benign 0.00
R5173:Plin5 UTSW 17 56,422,548 (GRCm39) splice site probably null
R5315:Plin5 UTSW 17 56,421,066 (GRCm39) missense probably benign 0.15
R5836:Plin5 UTSW 17 56,422,549 (GRCm39) critical splice donor site probably null
R7129:Plin5 UTSW 17 56,422,174 (GRCm39) missense probably null
R7510:Plin5 UTSW 17 56,420,975 (GRCm39) missense probably damaging 0.97
R9190:Plin5 UTSW 17 56,419,462 (GRCm39) missense probably damaging 1.00
R9248:Plin5 UTSW 17 56,419,324 (GRCm39) missense probably damaging 0.99
R9723:Plin5 UTSW 17 56,423,290 (GRCm39) missense probably damaging 1.00
X0028:Plin5 UTSW 17 56,423,324 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGCCCCATGTGTCTTTGGG -3'
(R):5'- ATCAAATAGGTTGGGCATTGGC -3'

Sequencing Primer
(F):5'- ATCCAACCTGGGTTTGAGTTCCAG -3'
(R):5'- GCTGTCTATTTAATGGAGGGAAAC -3'
Posted On 2020-07-28