Incidental Mutation 'R8305:Sema6b'
ID 641033
Institutional Source Beutler Lab
Gene Symbol Sema6b
Ensembl Gene ENSMUSG00000001227
Gene Name sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B
Synonyms semaZ, Seman, VIb, Sema
MMRRC Submission 067716-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.152) question?
Stock # R8305 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 56430085-56447343 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 56434084 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 377 (G377E)
Ref Sequence ENSEMBL: ENSMUSP00000001256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001256] [ENSMUST00000167545]
AlphaFold O54951
Predicted Effect probably damaging
Transcript: ENSMUST00000001256
AA Change: G377E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001256
Gene: ENSMUSG00000001227
AA Change: G377E

DomainStartEndE-ValueType
low complexity region 13 21 N/A INTRINSIC
Sema 66 496 2.48e-177 SMART
PSI 527 581 4.09e-1 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 655 685 N/A INTRINSIC
low complexity region 707 718 N/A INTRINSIC
low complexity region 739 760 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167545
AA Change: G377E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130985
Gene: ENSMUSG00000001227
AA Change: G377E

DomainStartEndE-ValueType
low complexity region 13 21 N/A INTRINSIC
Sema 66 496 2.48e-177 SMART
PSI 527 581 4.09e-1 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 655 685 N/A INTRINSIC
low complexity region 707 718 N/A INTRINSIC
low complexity region 739 760 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin family, a group of proteins characterized by the presence of a conserved semaphorin (sema) domain. Whereas some semaphorins are transmembrane proteins, others are secreted. Semaphorins play a major role in axon guidance. The protein encoded by this gene may be involved in both peripheral and central nervous system development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal mossy fiber and mossy cell axon projections, thickened suprapyramidal bundles, and elongated infrapyramydal bundles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 64,208,844 (GRCm39) E243K possibly damaging Het
Accsl A T 2: 93,696,423 (GRCm39) H58Q probably benign Het
Actl7a T A 4: 56,743,744 (GRCm39) F90L probably benign Het
Adam5 G A 8: 25,300,719 (GRCm39) A270V possibly damaging Het
Angptl3 A G 4: 98,919,548 (GRCm39) T103A probably damaging Het
Ankhd1 T C 18: 36,780,219 (GRCm39) L1757P possibly damaging Het
Apoa4 T A 9: 46,152,453 (GRCm39) M1K probably null Het
Arih1 T A 9: 59,303,770 (GRCm39) Q445L probably benign Het
Asb14 A T 14: 26,634,054 (GRCm39) I420L probably benign Het
Bbs2 A C 8: 94,800,953 (GRCm39) V626G probably damaging Het
Cep290 C A 10: 100,380,796 (GRCm39) A1678D probably benign Het
Cilp G A 9: 65,186,286 (GRCm39) G794S probably damaging Het
Clca3a1 C T 3: 144,464,927 (GRCm39) probably benign Het
Clca3b T A 3: 144,531,698 (GRCm39) N702I probably damaging Het
Col24a1 T C 3: 145,179,937 (GRCm39) V1143A probably benign Het
Cux1 T C 5: 136,388,863 (GRCm39) T223A probably benign Het
Defa30 A T 8: 21,625,475 (GRCm39) T80S probably benign Het
Dennd1a G A 2: 37,748,093 (GRCm39) L375F probably damaging Het
Dnajc6 C T 4: 101,480,984 (GRCm39) T675I probably damaging Het
Emc9 A G 14: 55,822,556 (GRCm39) V4A probably damaging Het
Enpp3 C G 10: 24,700,827 (GRCm39) probably null Het
Fam117b A G 1: 59,952,782 (GRCm39) T154A probably benign Het
Filip1 G T 9: 79,727,757 (GRCm39) Y287* probably null Het
Flt3 T C 5: 147,284,864 (GRCm39) D751G probably damaging Het
Frem1 T A 4: 82,918,226 (GRCm39) Q572L probably benign Het
Gja10 G A 4: 32,602,441 (GRCm39) probably benign Het
Gm39115 A G 7: 141,689,360 (GRCm39) C138R unknown Het
Gm7356 T A 17: 14,221,699 (GRCm39) Y110F probably benign Het
Igf2r T C 17: 12,952,747 (GRCm39) K233R probably benign Het
Igkv9-129 A T 6: 67,817,206 (GRCm39) E103D probably benign Het
Igsf11 C A 16: 38,827,586 (GRCm39) T48N probably damaging Het
Itpkc A T 7: 26,913,944 (GRCm39) Y506N probably damaging Het
Kat2a A C 11: 100,600,304 (GRCm39) M357R possibly damaging Het
Kbtbd12 T C 6: 88,595,132 (GRCm39) R233G possibly damaging Het
Kcnd2 T A 6: 21,726,197 (GRCm39) C563* probably null Het
Kcnu1 T C 8: 26,382,018 (GRCm39) V456A probably benign Het
Kif24 A G 4: 41,428,825 (GRCm39) V45A probably damaging Het
Macf1 A T 4: 123,289,414 (GRCm39) probably benign Het
Map3k19 T A 1: 127,745,007 (GRCm39) E1177D Het
Mdn1 G T 4: 32,725,107 (GRCm39) L2575F probably benign Het
Mga T A 2: 119,776,800 (GRCm39) M1569K possibly damaging Het
Mvk T C 5: 114,588,840 (GRCm39) Y161H probably damaging Het
Or10al3 T A 17: 38,012,389 (GRCm39) M276K probably benign Het
Or14c44 G T 7: 86,061,987 (GRCm39) C139F probably damaging Het
Or2n1 C A 17: 38,486,464 (GRCm39) T163K probably damaging Het
Pcdhb14 T A 18: 37,583,075 (GRCm39) V727E possibly damaging Het
Pcsk7 T G 9: 45,821,707 (GRCm39) V167G probably damaging Het
Plin5 T C 17: 56,422,221 (GRCm39) D146G probably benign Het
Plxna4 C T 6: 32,188,000 (GRCm39) G879R possibly damaging Het
Prss58 C T 6: 40,872,594 (GRCm39) A171T probably benign Het
Pum1 A G 4: 130,499,231 (GRCm39) I1016V probably benign Het
Rbm43 A G 2: 51,816,712 (GRCm39) V85A probably damaging Het
Rdh16f2 T A 10: 127,712,864 (GRCm39) D287E probably damaging Het
Rptor T A 11: 119,702,812 (GRCm39) L393Q probably damaging Het
Sbf2 T G 7: 109,970,825 (GRCm39) H857P possibly damaging Het
Scn8a A C 15: 100,938,387 (GRCm39) T1919P probably benign Het
Senp7 T A 16: 55,975,603 (GRCm39) D436E probably damaging Het
Slc6a17 T A 3: 107,380,901 (GRCm39) I535F probably benign Het
Sptbn2 T A 19: 4,779,158 (GRCm39) S281T possibly damaging Het
Stt3b T C 9: 115,083,999 (GRCm39) I392M probably damaging Het
Tfap2b T C 1: 19,296,660 (GRCm39) V201A possibly damaging Het
Timm10b T C 7: 105,289,876 (GRCm39) probably benign Het
Ttc23 A C 7: 67,312,135 (GRCm39) D14A probably damaging Het
Usp32 A T 11: 84,923,011 (GRCm39) L636I possibly damaging Het
Vgll4 G T 6: 114,867,613 (GRCm39) H79Q probably damaging Het
Vps13d A G 4: 144,818,858 (GRCm39) I3047T Het
Zan T C 5: 137,448,813 (GRCm39) E1680G unknown Het
Other mutations in Sema6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Sema6b APN 17 56,437,048 (GRCm39) missense probably damaging 1.00
IGL01102:Sema6b APN 17 56,439,761 (GRCm39) missense possibly damaging 0.91
IGL01533:Sema6b APN 17 56,436,499 (GRCm39) splice site probably benign
IGL01611:Sema6b APN 17 56,436,969 (GRCm39) splice site probably null
IGL01996:Sema6b APN 17 56,438,157 (GRCm39) missense probably damaging 1.00
IGL02118:Sema6b APN 17 56,439,821 (GRCm39) missense probably benign
R0010:Sema6b UTSW 17 56,431,105 (GRCm39) missense probably benign 0.06
R0066:Sema6b UTSW 17 56,435,271 (GRCm39) missense possibly damaging 0.83
R0066:Sema6b UTSW 17 56,435,271 (GRCm39) missense possibly damaging 0.83
R0525:Sema6b UTSW 17 56,433,630 (GRCm39) missense probably damaging 0.96
R0635:Sema6b UTSW 17 56,436,971 (GRCm39) critical splice donor site probably null
R1129:Sema6b UTSW 17 56,431,347 (GRCm39) missense probably benign
R1927:Sema6b UTSW 17 56,439,797 (GRCm39) missense probably benign 0.00
R2211:Sema6b UTSW 17 56,431,741 (GRCm39) missense probably benign 0.00
R4081:Sema6b UTSW 17 56,435,307 (GRCm39) missense probably damaging 0.99
R5013:Sema6b UTSW 17 56,439,497 (GRCm39) critical splice donor site probably null
R5296:Sema6b UTSW 17 56,434,091 (GRCm39) critical splice acceptor site probably null
R5314:Sema6b UTSW 17 56,435,413 (GRCm39) nonsense probably null
R6317:Sema6b UTSW 17 56,431,047 (GRCm39) missense probably benign 0.26
R6419:Sema6b UTSW 17 56,439,784 (GRCm39) nonsense probably null
R7255:Sema6b UTSW 17 56,432,336 (GRCm39) missense probably benign 0.01
R7289:Sema6b UTSW 17 56,432,573 (GRCm39) missense possibly damaging 0.77
R7805:Sema6b UTSW 17 56,438,555 (GRCm39) missense probably damaging 1.00
R8157:Sema6b UTSW 17 56,435,448 (GRCm39) missense probably damaging 1.00
R8290:Sema6b UTSW 17 56,431,803 (GRCm39) missense possibly damaging 0.93
R9502:Sema6b UTSW 17 56,439,500 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGAAGTACTGGGATGCCCTC -3'
(R):5'- AAGTGTGGGCAAAGACCCTG -3'

Sequencing Primer
(F):5'- TCCTCCCCAGGACTGACC -3'
(R):5'- TGTGAGGCCCAGGCAAATC -3'
Posted On 2020-07-28