Incidental Mutation 'R8305:Ankhd1'
ID 641034
Institutional Source Beutler Lab
Gene Symbol Ankhd1
Ensembl Gene ENSMUSG00000024483
Gene Name ankyrin repeat and KH domain containing 1
Synonyms A530027J04Rik, 9130019P20Rik, 4933432B13Rik, 1110004O12Rik
MMRRC Submission 067716-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8305 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 36693656-36791961 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36780219 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1757 (L1757P)
Ref Sequence ENSEMBL: ENSMUSP00000123270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006205] [ENSMUST00000142977] [ENSMUST00000155329]
AlphaFold E9PUR0
Predicted Effect probably damaging
Transcript: ENSMUST00000006205
AA Change: L1757P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006205
Gene: ENSMUSG00000024483
AA Change: L1757P

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000040300
Gene: ENSMUSG00000024483
AA Change: L246P

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
low complexity region 28 47 N/A INTRINSIC
low complexity region 75 94 N/A INTRINSIC
KH 183 253 5.04e-13 SMART
low complexity region 458 491 N/A INTRINSIC
low complexity region 531 547 N/A INTRINSIC
low complexity region 554 571 N/A INTRINSIC
low complexity region 824 836 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130035
SMART Domains Protein: ENSMUSP00000117110
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
ANK 2 26 5.35e2 SMART
ANK 30 59 9.41e-6 SMART
ANK 63 96 3.8e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140061
SMART Domains Protein: ENSMUSP00000121811
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
low complexity region 54 70 N/A INTRINSIC
low complexity region 77 94 N/A INTRINSIC
low complexity region 355 375 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142977
AA Change: L1757P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120290
Gene: ENSMUSG00000024483
AA Change: L1757P

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153612
SMART Domains Protein: ENSMUSP00000116462
Gene: ENSMUSG00000024483

DomainStartEndE-ValueType
ANK 10 39 9.41e-6 SMART
ANK 43 76 3.8e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000155329
AA Change: L1757P

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123270
Gene: ENSMUSG00000024483
AA Change: L1757P

DomainStartEndE-ValueType
low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2342 2362 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 64,208,844 (GRCm39) E243K possibly damaging Het
Accsl A T 2: 93,696,423 (GRCm39) H58Q probably benign Het
Actl7a T A 4: 56,743,744 (GRCm39) F90L probably benign Het
Adam5 G A 8: 25,300,719 (GRCm39) A270V possibly damaging Het
Angptl3 A G 4: 98,919,548 (GRCm39) T103A probably damaging Het
Apoa4 T A 9: 46,152,453 (GRCm39) M1K probably null Het
Arih1 T A 9: 59,303,770 (GRCm39) Q445L probably benign Het
Asb14 A T 14: 26,634,054 (GRCm39) I420L probably benign Het
Bbs2 A C 8: 94,800,953 (GRCm39) V626G probably damaging Het
Cep290 C A 10: 100,380,796 (GRCm39) A1678D probably benign Het
Cilp G A 9: 65,186,286 (GRCm39) G794S probably damaging Het
Clca3a1 C T 3: 144,464,927 (GRCm39) probably benign Het
Clca3b T A 3: 144,531,698 (GRCm39) N702I probably damaging Het
Col24a1 T C 3: 145,179,937 (GRCm39) V1143A probably benign Het
Cux1 T C 5: 136,388,863 (GRCm39) T223A probably benign Het
Defa30 A T 8: 21,625,475 (GRCm39) T80S probably benign Het
Dennd1a G A 2: 37,748,093 (GRCm39) L375F probably damaging Het
Dnajc6 C T 4: 101,480,984 (GRCm39) T675I probably damaging Het
Emc9 A G 14: 55,822,556 (GRCm39) V4A probably damaging Het
Enpp3 C G 10: 24,700,827 (GRCm39) probably null Het
Fam117b A G 1: 59,952,782 (GRCm39) T154A probably benign Het
Filip1 G T 9: 79,727,757 (GRCm39) Y287* probably null Het
Flt3 T C 5: 147,284,864 (GRCm39) D751G probably damaging Het
Frem1 T A 4: 82,918,226 (GRCm39) Q572L probably benign Het
Gja10 G A 4: 32,602,441 (GRCm39) probably benign Het
Gm39115 A G 7: 141,689,360 (GRCm39) C138R unknown Het
Gm7356 T A 17: 14,221,699 (GRCm39) Y110F probably benign Het
Igf2r T C 17: 12,952,747 (GRCm39) K233R probably benign Het
Igkv9-129 A T 6: 67,817,206 (GRCm39) E103D probably benign Het
Igsf11 C A 16: 38,827,586 (GRCm39) T48N probably damaging Het
Itpkc A T 7: 26,913,944 (GRCm39) Y506N probably damaging Het
Kat2a A C 11: 100,600,304 (GRCm39) M357R possibly damaging Het
Kbtbd12 T C 6: 88,595,132 (GRCm39) R233G possibly damaging Het
Kcnd2 T A 6: 21,726,197 (GRCm39) C563* probably null Het
Kcnu1 T C 8: 26,382,018 (GRCm39) V456A probably benign Het
Kif24 A G 4: 41,428,825 (GRCm39) V45A probably damaging Het
Macf1 A T 4: 123,289,414 (GRCm39) probably benign Het
Map3k19 T A 1: 127,745,007 (GRCm39) E1177D Het
Mdn1 G T 4: 32,725,107 (GRCm39) L2575F probably benign Het
Mga T A 2: 119,776,800 (GRCm39) M1569K possibly damaging Het
Mvk T C 5: 114,588,840 (GRCm39) Y161H probably damaging Het
Or10al3 T A 17: 38,012,389 (GRCm39) M276K probably benign Het
Or14c44 G T 7: 86,061,987 (GRCm39) C139F probably damaging Het
Or2n1 C A 17: 38,486,464 (GRCm39) T163K probably damaging Het
Pcdhb14 T A 18: 37,583,075 (GRCm39) V727E possibly damaging Het
Pcsk7 T G 9: 45,821,707 (GRCm39) V167G probably damaging Het
Plin5 T C 17: 56,422,221 (GRCm39) D146G probably benign Het
Plxna4 C T 6: 32,188,000 (GRCm39) G879R possibly damaging Het
Prss58 C T 6: 40,872,594 (GRCm39) A171T probably benign Het
Pum1 A G 4: 130,499,231 (GRCm39) I1016V probably benign Het
Rbm43 A G 2: 51,816,712 (GRCm39) V85A probably damaging Het
Rdh16f2 T A 10: 127,712,864 (GRCm39) D287E probably damaging Het
Rptor T A 11: 119,702,812 (GRCm39) L393Q probably damaging Het
Sbf2 T G 7: 109,970,825 (GRCm39) H857P possibly damaging Het
Scn8a A C 15: 100,938,387 (GRCm39) T1919P probably benign Het
Sema6b C T 17: 56,434,084 (GRCm39) G377E probably damaging Het
Senp7 T A 16: 55,975,603 (GRCm39) D436E probably damaging Het
Slc6a17 T A 3: 107,380,901 (GRCm39) I535F probably benign Het
Sptbn2 T A 19: 4,779,158 (GRCm39) S281T possibly damaging Het
Stt3b T C 9: 115,083,999 (GRCm39) I392M probably damaging Het
Tfap2b T C 1: 19,296,660 (GRCm39) V201A possibly damaging Het
Timm10b T C 7: 105,289,876 (GRCm39) probably benign Het
Ttc23 A C 7: 67,312,135 (GRCm39) D14A probably damaging Het
Usp32 A T 11: 84,923,011 (GRCm39) L636I possibly damaging Het
Vgll4 G T 6: 114,867,613 (GRCm39) H79Q probably damaging Het
Vps13d A G 4: 144,818,858 (GRCm39) I3047T Het
Zan T C 5: 137,448,813 (GRCm39) E1680G unknown Het
Other mutations in Ankhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ankhd1 APN 18 36,798,512 (GRCm39) unclassified probably benign
IGL00927:Ankhd1 APN 18 36,765,125 (GRCm39) missense probably benign 0.01
IGL01367:Ankhd1 APN 18 36,711,696 (GRCm39) missense probably benign 0.16
IGL01624:Ankhd1 APN 18 36,791,066 (GRCm39) missense probably damaging 1.00
IGL01725:Ankhd1 APN 18 36,781,206 (GRCm39) missense probably benign 0.04
IGL01767:Ankhd1 APN 18 36,781,427 (GRCm39) missense probably damaging 1.00
IGL02005:Ankhd1 APN 18 36,781,479 (GRCm39) missense probably damaging 1.00
IGL02009:Ankhd1 APN 18 36,757,714 (GRCm39) missense probably damaging 1.00
IGL02246:Ankhd1 APN 18 36,789,779 (GRCm39) missense probably damaging 1.00
IGL02336:Ankhd1 APN 18 36,727,867 (GRCm39) missense probably damaging 0.97
IGL02628:Ankhd1 APN 18 36,780,756 (GRCm39) missense probably benign 0.00
IGL02644:Ankhd1 APN 18 36,711,828 (GRCm39) critical splice donor site probably null
IGL02735:Ankhd1 APN 18 36,781,599 (GRCm39) missense probably benign 0.00
IGL02877:Ankhd1 APN 18 36,727,876 (GRCm39) missense probably damaging 1.00
IGL03129:Ankhd1 APN 18 36,791,061 (GRCm39) nonsense probably null
IGL03163:Ankhd1 APN 18 36,780,681 (GRCm39) missense probably damaging 0.97
IGL03182:Ankhd1 APN 18 36,711,827 (GRCm39) missense probably benign 0.06
IGL03184:Ankhd1 APN 18 36,780,830 (GRCm39) missense probably damaging 1.00
IGL03398:Ankhd1 APN 18 36,789,890 (GRCm39) splice site probably benign
FR4304:Ankhd1 UTSW 18 36,693,977 (GRCm39) small insertion probably benign
R0051:Ankhd1 UTSW 18 36,780,241 (GRCm39) unclassified probably benign
R0089:Ankhd1 UTSW 18 36,773,409 (GRCm39) missense probably damaging 0.99
R0105:Ankhd1 UTSW 18 36,779,819 (GRCm39) missense probably damaging 1.00
R0149:Ankhd1 UTSW 18 36,780,267 (GRCm39) missense probably damaging 1.00
R0243:Ankhd1 UTSW 18 36,767,787 (GRCm39) missense probably damaging 1.00
R0322:Ankhd1 UTSW 18 36,791,061 (GRCm39) nonsense probably null
R0361:Ankhd1 UTSW 18 36,780,267 (GRCm39) missense probably damaging 1.00
R0389:Ankhd1 UTSW 18 36,777,652 (GRCm39) missense possibly damaging 0.48
R0418:Ankhd1 UTSW 18 36,767,353 (GRCm39) missense probably damaging 1.00
R0443:Ankhd1 UTSW 18 36,777,652 (GRCm39) missense possibly damaging 0.48
R0540:Ankhd1 UTSW 18 36,773,333 (GRCm39) missense probably damaging 1.00
R0607:Ankhd1 UTSW 18 36,773,333 (GRCm39) missense probably damaging 1.00
R0738:Ankhd1 UTSW 18 36,778,302 (GRCm39) splice site probably benign
R1127:Ankhd1 UTSW 18 36,767,399 (GRCm39) missense probably damaging 1.00
R1434:Ankhd1 UTSW 18 36,758,212 (GRCm39) missense probably benign 0.09
R1742:Ankhd1 UTSW 18 36,758,318 (GRCm39) missense probably damaging 1.00
R1776:Ankhd1 UTSW 18 36,780,361 (GRCm39) missense probably benign 0.17
R1856:Ankhd1 UTSW 18 36,777,580 (GRCm39) missense probably benign 0.00
R1923:Ankhd1 UTSW 18 36,781,083 (GRCm39) missense probably benign 0.08
R2044:Ankhd1 UTSW 18 36,778,166 (GRCm39) missense probably benign 0.31
R2112:Ankhd1 UTSW 18 36,774,679 (GRCm39) missense probably damaging 1.00
R2115:Ankhd1 UTSW 18 36,767,361 (GRCm39) missense probably damaging 1.00
R2136:Ankhd1 UTSW 18 36,780,674 (GRCm39) missense probably benign
R2196:Ankhd1 UTSW 18 36,781,432 (GRCm39) missense probably damaging 1.00
R2291:Ankhd1 UTSW 18 36,777,386 (GRCm39) missense probably benign 0.31
R2305:Ankhd1 UTSW 18 36,775,979 (GRCm39) missense possibly damaging 0.59
R2309:Ankhd1 UTSW 18 36,757,818 (GRCm39) missense probably damaging 1.00
R2519:Ankhd1 UTSW 18 36,711,596 (GRCm39) splice site probably null
R2958:Ankhd1 UTSW 18 36,767,782 (GRCm39) missense probably damaging 1.00
R3978:Ankhd1 UTSW 18 36,780,666 (GRCm39) missense probably damaging 0.96
R3980:Ankhd1 UTSW 18 36,780,666 (GRCm39) missense probably damaging 0.96
R4159:Ankhd1 UTSW 18 36,722,593 (GRCm39) missense possibly damaging 0.91
R4199:Ankhd1 UTSW 18 36,794,101 (GRCm39) unclassified probably benign
R4323:Ankhd1 UTSW 18 36,711,686 (GRCm39) missense probably damaging 1.00
R4356:Ankhd1 UTSW 18 36,776,096 (GRCm39) nonsense probably null
R4496:Ankhd1 UTSW 18 36,693,839 (GRCm39) missense probably damaging 0.98
R4551:Ankhd1 UTSW 18 36,788,560 (GRCm39) splice site probably null
R4590:Ankhd1 UTSW 18 36,716,697 (GRCm39) missense probably damaging 1.00
R4667:Ankhd1 UTSW 18 36,781,074 (GRCm39) missense possibly damaging 0.77
R4889:Ankhd1 UTSW 18 36,711,787 (GRCm39) missense probably null 0.00
R4923:Ankhd1 UTSW 18 36,722,505 (GRCm39) missense probably damaging 1.00
R5091:Ankhd1 UTSW 18 36,758,080 (GRCm39) missense possibly damaging 0.68
R5254:Ankhd1 UTSW 18 36,789,768 (GRCm39) missense probably benign 0.05
R5314:Ankhd1 UTSW 18 36,694,111 (GRCm39) splice site probably null
R5336:Ankhd1 UTSW 18 36,779,769 (GRCm39) missense probably damaging 1.00
R5367:Ankhd1 UTSW 18 36,722,461 (GRCm39) missense probably damaging 1.00
R5384:Ankhd1 UTSW 18 36,724,548 (GRCm39) missense probably damaging 1.00
R5385:Ankhd1 UTSW 18 36,724,548 (GRCm39) missense probably damaging 1.00
R5387:Ankhd1 UTSW 18 36,767,697 (GRCm39) missense probably damaging 1.00
R5458:Ankhd1 UTSW 18 36,781,538 (GRCm39) missense probably benign 0.01
R5599:Ankhd1 UTSW 18 36,693,860 (GRCm39) missense probably damaging 0.98
R5659:Ankhd1 UTSW 18 36,694,103 (GRCm39) missense probably damaging 1.00
R5750:Ankhd1 UTSW 18 36,757,955 (GRCm39) missense probably benign 0.00
R5874:Ankhd1 UTSW 18 36,773,322 (GRCm39) missense possibly damaging 0.92
R5894:Ankhd1 UTSW 18 36,780,577 (GRCm39) missense probably damaging 0.99
R5969:Ankhd1 UTSW 18 36,733,887 (GRCm39) missense probably damaging 1.00
R6133:Ankhd1 UTSW 18 36,758,179 (GRCm39) missense possibly damaging 0.77
R6190:Ankhd1 UTSW 18 36,744,862 (GRCm39) missense possibly damaging 0.84
R6247:Ankhd1 UTSW 18 36,787,199 (GRCm39) missense probably benign 0.00
R6512:Ankhd1 UTSW 18 36,724,509 (GRCm39) missense probably damaging 1.00
R6649:Ankhd1 UTSW 18 36,733,836 (GRCm39) splice site probably null
R6653:Ankhd1 UTSW 18 36,733,836 (GRCm39) splice site probably null
R6763:Ankhd1 UTSW 18 36,776,022 (GRCm39) missense probably benign 0.31
R6976:Ankhd1 UTSW 18 36,781,307 (GRCm39) missense probably benign 0.00
R7075:Ankhd1 UTSW 18 36,693,042 (GRCm39) missense
R7208:Ankhd1 UTSW 18 36,758,081 (GRCm39) missense probably benign
R7305:Ankhd1 UTSW 18 36,765,258 (GRCm39) missense
R7615:Ankhd1 UTSW 18 36,789,826 (GRCm39) missense
R7654:Ankhd1 UTSW 18 36,727,154 (GRCm39) missense probably damaging 1.00
R7781:Ankhd1 UTSW 18 36,758,258 (GRCm39) missense probably damaging 1.00
R7842:Ankhd1 UTSW 18 36,780,881 (GRCm39) missense probably benign 0.00
R7965:Ankhd1 UTSW 18 36,791,465 (GRCm39) missense
R8006:Ankhd1 UTSW 18 36,781,772 (GRCm39) missense
R8037:Ankhd1 UTSW 18 36,771,676 (GRCm39) missense probably damaging 0.98
R8123:Ankhd1 UTSW 18 36,708,136 (GRCm39) missense
R8195:Ankhd1 UTSW 18 36,787,230 (GRCm39) missense
R8708:Ankhd1 UTSW 18 36,727,344 (GRCm39) missense probably damaging 1.00
R8827:Ankhd1 UTSW 18 36,757,633 (GRCm39) nonsense probably null
R9138:Ankhd1 UTSW 18 36,693,961 (GRCm39) small deletion probably benign
R9139:Ankhd1 UTSW 18 36,711,810 (GRCm39) missense
R9186:Ankhd1 UTSW 18 36,767,383 (GRCm39) missense possibly damaging 0.95
R9245:Ankhd1 UTSW 18 36,788,653 (GRCm39) missense
R9254:Ankhd1 UTSW 18 36,777,680 (GRCm39) missense probably benign 0.03
R9262:Ankhd1 UTSW 18 36,765,799 (GRCm39) missense
R9379:Ankhd1 UTSW 18 36,777,680 (GRCm39) missense probably benign 0.03
R9436:Ankhd1 UTSW 18 36,774,654 (GRCm39) missense probably benign 0.04
R9436:Ankhd1 UTSW 18 36,694,041 (GRCm39) missense probably benign 0.39
R9541:Ankhd1 UTSW 18 36,757,697 (GRCm39) missense
R9584:Ankhd1 UTSW 18 36,798,504 (GRCm39) missense probably benign 0.06
R9664:Ankhd1 UTSW 18 36,780,878 (GRCm39) missense probably benign 0.03
RF001:Ankhd1 UTSW 18 36,693,974 (GRCm39) small insertion probably benign
RF004:Ankhd1 UTSW 18 36,693,963 (GRCm39) small insertion probably benign
RF007:Ankhd1 UTSW 18 36,693,962 (GRCm39) small insertion probably benign
RF008:Ankhd1 UTSW 18 36,693,977 (GRCm39) small insertion probably benign
RF009:Ankhd1 UTSW 18 36,693,975 (GRCm39) small insertion probably benign
RF013:Ankhd1 UTSW 18 36,693,979 (GRCm39) small insertion probably benign
RF016:Ankhd1 UTSW 18 36,693,963 (GRCm39) small insertion probably benign
RF016:Ankhd1 UTSW 18 36,693,962 (GRCm39) small insertion probably benign
RF017:Ankhd1 UTSW 18 36,693,962 (GRCm39) small insertion probably benign
RF018:Ankhd1 UTSW 18 36,693,965 (GRCm39) small insertion probably benign
RF026:Ankhd1 UTSW 18 36,693,965 (GRCm39) small insertion probably benign
RF030:Ankhd1 UTSW 18 36,693,980 (GRCm39) small insertion probably benign
RF030:Ankhd1 UTSW 18 36,693,966 (GRCm39) small insertion probably benign
RF039:Ankhd1 UTSW 18 36,693,971 (GRCm39) small insertion probably benign
RF043:Ankhd1 UTSW 18 36,693,970 (GRCm39) small insertion probably benign
RF046:Ankhd1 UTSW 18 36,693,979 (GRCm39) small insertion probably benign
RF047:Ankhd1 UTSW 18 36,693,976 (GRCm39) small insertion probably benign
RF047:Ankhd1 UTSW 18 36,693,970 (GRCm39) small insertion probably benign
RF049:Ankhd1 UTSW 18 36,693,976 (GRCm39) small insertion probably benign
RF050:Ankhd1 UTSW 18 36,693,980 (GRCm39) small insertion probably benign
RF054:Ankhd1 UTSW 18 36,693,982 (GRCm39) small insertion probably benign
RF057:Ankhd1 UTSW 18 36,693,982 (GRCm39) small insertion probably benign
RF060:Ankhd1 UTSW 18 36,693,975 (GRCm39) small insertion probably benign
RF061:Ankhd1 UTSW 18 36,693,974 (GRCm39) small insertion probably benign
RF062:Ankhd1 UTSW 18 36,693,971 (GRCm39) small insertion probably benign
X0027:Ankhd1 UTSW 18 36,757,885 (GRCm39) missense probably damaging 1.00
X0065:Ankhd1 UTSW 18 36,711,817 (GRCm39) nonsense probably null
X0066:Ankhd1 UTSW 18 36,779,757 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGCCCATATTGATGTGGATAAAC -3'
(R):5'- ATGTCACAAGAGCTGGAGCAC -3'

Sequencing Primer
(F):5'- TATTAAGCCCTAGGTTCAACTCCAG -3'
(R):5'- CCCAAGGGAAATGCATTCTTGCTG -3'
Posted On 2020-07-28