Incidental Mutation 'R8305:Pcdhb14'
ID 641035
Institutional Source Beutler Lab
Gene Symbol Pcdhb14
Ensembl Gene ENSMUSG00000044043
Gene Name protocadherin beta 14
Synonyms Pcdhb17, 2210006M07Rik, PcdhbN
MMRRC Submission 067716-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R8305 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 37580710-37584147 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37583075 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 727 (V727E)
Ref Sequence ENSEMBL: ENSMUSP00000054111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052387] [ENSMUST00000056915] [ENSMUST00000115661] [ENSMUST00000194544]
AlphaFold Q6PB90
PDB Structure Solution structure of mouse protocadherin beta 14 (26-137) [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052387
AA Change: V727E

PolyPhen 2 Score 0.484 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000054111
Gene: ENSMUSG00000044043
AA Change: V727E

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 1.4e-35 PFAM
CA 155 240 1.53e-20 SMART
CA 264 345 3.52e-29 SMART
CA 368 449 2.24e-22 SMART
CA 473 559 2.38e-26 SMART
CA 589 670 4.12e-12 SMART
Pfam:Cadherin_C_2 685 768 4.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056915
SMART Domains Protein: ENSMUSP00000061087
Gene: ENSMUSG00000047307

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 58 130 5.5e-1 SMART
CA 154 239 8.55e-19 SMART
CA 263 343 3.36e-26 SMART
CA 366 447 2.24e-22 SMART
CA 471 557 1.08e-24 SMART
CA 587 668 1.25e-11 SMART
Pfam:Cadherin_C_2 685 768 2.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 64,208,844 (GRCm39) E243K possibly damaging Het
Accsl A T 2: 93,696,423 (GRCm39) H58Q probably benign Het
Actl7a T A 4: 56,743,744 (GRCm39) F90L probably benign Het
Adam5 G A 8: 25,300,719 (GRCm39) A270V possibly damaging Het
Angptl3 A G 4: 98,919,548 (GRCm39) T103A probably damaging Het
Ankhd1 T C 18: 36,780,219 (GRCm39) L1757P possibly damaging Het
Apoa4 T A 9: 46,152,453 (GRCm39) M1K probably null Het
Arih1 T A 9: 59,303,770 (GRCm39) Q445L probably benign Het
Asb14 A T 14: 26,634,054 (GRCm39) I420L probably benign Het
Bbs2 A C 8: 94,800,953 (GRCm39) V626G probably damaging Het
Cep290 C A 10: 100,380,796 (GRCm39) A1678D probably benign Het
Cilp G A 9: 65,186,286 (GRCm39) G794S probably damaging Het
Clca3a1 C T 3: 144,464,927 (GRCm39) probably benign Het
Clca3b T A 3: 144,531,698 (GRCm39) N702I probably damaging Het
Col24a1 T C 3: 145,179,937 (GRCm39) V1143A probably benign Het
Cux1 T C 5: 136,388,863 (GRCm39) T223A probably benign Het
Defa30 A T 8: 21,625,475 (GRCm39) T80S probably benign Het
Dennd1a G A 2: 37,748,093 (GRCm39) L375F probably damaging Het
Dnajc6 C T 4: 101,480,984 (GRCm39) T675I probably damaging Het
Emc9 A G 14: 55,822,556 (GRCm39) V4A probably damaging Het
Enpp3 C G 10: 24,700,827 (GRCm39) probably null Het
Fam117b A G 1: 59,952,782 (GRCm39) T154A probably benign Het
Filip1 G T 9: 79,727,757 (GRCm39) Y287* probably null Het
Flt3 T C 5: 147,284,864 (GRCm39) D751G probably damaging Het
Frem1 T A 4: 82,918,226 (GRCm39) Q572L probably benign Het
Gja10 G A 4: 32,602,441 (GRCm39) probably benign Het
Gm39115 A G 7: 141,689,360 (GRCm39) C138R unknown Het
Gm7356 T A 17: 14,221,699 (GRCm39) Y110F probably benign Het
Igf2r T C 17: 12,952,747 (GRCm39) K233R probably benign Het
Igkv9-129 A T 6: 67,817,206 (GRCm39) E103D probably benign Het
Igsf11 C A 16: 38,827,586 (GRCm39) T48N probably damaging Het
Itpkc A T 7: 26,913,944 (GRCm39) Y506N probably damaging Het
Kat2a A C 11: 100,600,304 (GRCm39) M357R possibly damaging Het
Kbtbd12 T C 6: 88,595,132 (GRCm39) R233G possibly damaging Het
Kcnd2 T A 6: 21,726,197 (GRCm39) C563* probably null Het
Kcnu1 T C 8: 26,382,018 (GRCm39) V456A probably benign Het
Kif24 A G 4: 41,428,825 (GRCm39) V45A probably damaging Het
Macf1 A T 4: 123,289,414 (GRCm39) probably benign Het
Map3k19 T A 1: 127,745,007 (GRCm39) E1177D Het
Mdn1 G T 4: 32,725,107 (GRCm39) L2575F probably benign Het
Mga T A 2: 119,776,800 (GRCm39) M1569K possibly damaging Het
Mvk T C 5: 114,588,840 (GRCm39) Y161H probably damaging Het
Or10al3 T A 17: 38,012,389 (GRCm39) M276K probably benign Het
Or14c44 G T 7: 86,061,987 (GRCm39) C139F probably damaging Het
Or2n1 C A 17: 38,486,464 (GRCm39) T163K probably damaging Het
Pcsk7 T G 9: 45,821,707 (GRCm39) V167G probably damaging Het
Plin5 T C 17: 56,422,221 (GRCm39) D146G probably benign Het
Plxna4 C T 6: 32,188,000 (GRCm39) G879R possibly damaging Het
Prss58 C T 6: 40,872,594 (GRCm39) A171T probably benign Het
Pum1 A G 4: 130,499,231 (GRCm39) I1016V probably benign Het
Rbm43 A G 2: 51,816,712 (GRCm39) V85A probably damaging Het
Rdh16f2 T A 10: 127,712,864 (GRCm39) D287E probably damaging Het
Rptor T A 11: 119,702,812 (GRCm39) L393Q probably damaging Het
Sbf2 T G 7: 109,970,825 (GRCm39) H857P possibly damaging Het
Scn8a A C 15: 100,938,387 (GRCm39) T1919P probably benign Het
Sema6b C T 17: 56,434,084 (GRCm39) G377E probably damaging Het
Senp7 T A 16: 55,975,603 (GRCm39) D436E probably damaging Het
Slc6a17 T A 3: 107,380,901 (GRCm39) I535F probably benign Het
Sptbn2 T A 19: 4,779,158 (GRCm39) S281T possibly damaging Het
Stt3b T C 9: 115,083,999 (GRCm39) I392M probably damaging Het
Tfap2b T C 1: 19,296,660 (GRCm39) V201A possibly damaging Het
Timm10b T C 7: 105,289,876 (GRCm39) probably benign Het
Ttc23 A C 7: 67,312,135 (GRCm39) D14A probably damaging Het
Usp32 A T 11: 84,923,011 (GRCm39) L636I possibly damaging Het
Vgll4 G T 6: 114,867,613 (GRCm39) H79Q probably damaging Het
Vps13d A G 4: 144,818,858 (GRCm39) I3047T Het
Zan T C 5: 137,448,813 (GRCm39) E1680G unknown Het
Other mutations in Pcdhb14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Pcdhb14 APN 18 37,583,086 (GRCm39) missense probably benign 0.28
IGL02314:Pcdhb14 APN 18 37,583,248 (GRCm39) missense probably benign 0.03
IGL02411:Pcdhb14 APN 18 37,582,823 (GRCm39) missense possibly damaging 0.78
IGL02553:Pcdhb14 APN 18 37,581,071 (GRCm39) nonsense probably null
IGL02797:Pcdhb14 APN 18 37,582,904 (GRCm39) missense probably damaging 1.00
IGL03184:Pcdhb14 APN 18 37,582,085 (GRCm39) missense probably benign 0.00
IGL03352:Pcdhb14 APN 18 37,582,057 (GRCm39) missense possibly damaging 0.67
R0166:Pcdhb14 UTSW 18 37,581,542 (GRCm39) splice site probably null
R0467:Pcdhb14 UTSW 18 37,582,277 (GRCm39) missense probably damaging 0.98
R0675:Pcdhb14 UTSW 18 37,581,392 (GRCm39) missense possibly damaging 0.91
R0730:Pcdhb14 UTSW 18 37,581,921 (GRCm39) missense probably damaging 1.00
R1119:Pcdhb14 UTSW 18 37,581,640 (GRCm39) missense probably damaging 0.99
R1121:Pcdhb14 UTSW 18 37,582,645 (GRCm39) missense probably damaging 1.00
R1338:Pcdhb14 UTSW 18 37,582,943 (GRCm39) missense probably benign 0.00
R1726:Pcdhb14 UTSW 18 37,582,647 (GRCm39) nonsense probably null
R1743:Pcdhb14 UTSW 18 37,581,231 (GRCm39) missense probably benign 0.01
R1779:Pcdhb14 UTSW 18 37,582,535 (GRCm39) missense probably damaging 1.00
R1795:Pcdhb14 UTSW 18 37,582,588 (GRCm39) missense probably benign
R2131:Pcdhb14 UTSW 18 37,580,923 (GRCm39) missense probably benign 0.00
R2133:Pcdhb14 UTSW 18 37,580,923 (GRCm39) missense probably benign 0.00
R3792:Pcdhb14 UTSW 18 37,582,715 (GRCm39) missense probably damaging 1.00
R3916:Pcdhb14 UTSW 18 37,581,598 (GRCm39) missense possibly damaging 0.48
R4197:Pcdhb14 UTSW 18 37,581,358 (GRCm39) missense probably benign 0.01
R4282:Pcdhb14 UTSW 18 37,583,195 (GRCm39) missense probably damaging 1.00
R4657:Pcdhb14 UTSW 18 37,581,900 (GRCm39) missense possibly damaging 0.92
R4801:Pcdhb14 UTSW 18 37,581,331 (GRCm39) missense probably benign 0.28
R4802:Pcdhb14 UTSW 18 37,581,331 (GRCm39) missense probably benign 0.28
R5022:Pcdhb14 UTSW 18 37,583,223 (GRCm39) missense probably benign 0.03
R5034:Pcdhb14 UTSW 18 37,581,859 (GRCm39) missense probably damaging 0.98
R5664:Pcdhb14 UTSW 18 37,582,049 (GRCm39) missense possibly damaging 0.54
R5840:Pcdhb14 UTSW 18 37,581,803 (GRCm39) missense probably benign 0.23
R5966:Pcdhb14 UTSW 18 37,581,295 (GRCm39) missense probably benign
R6090:Pcdhb14 UTSW 18 37,581,659 (GRCm39) missense probably benign 0.45
R6148:Pcdhb14 UTSW 18 37,582,283 (GRCm39) missense probably damaging 1.00
R6187:Pcdhb14 UTSW 18 37,581,497 (GRCm39) missense probably damaging 1.00
R6972:Pcdhb14 UTSW 18 37,582,745 (GRCm39) missense probably damaging 1.00
R7394:Pcdhb14 UTSW 18 37,581,961 (GRCm39) missense probably benign 0.29
R7510:Pcdhb14 UTSW 18 37,582,645 (GRCm39) missense probably damaging 0.97
R7724:Pcdhb14 UTSW 18 37,581,937 (GRCm39) missense possibly damaging 0.62
R7757:Pcdhb14 UTSW 18 37,582,887 (GRCm39) missense possibly damaging 0.95
R8338:Pcdhb14 UTSW 18 37,582,175 (GRCm39) missense probably damaging 1.00
R8497:Pcdhb14 UTSW 18 37,582,349 (GRCm39) missense probably benign 0.02
R8700:Pcdhb14 UTSW 18 37,582,652 (GRCm39) missense probably damaging 1.00
R8792:Pcdhb14 UTSW 18 37,582,541 (GRCm39) missense probably damaging 0.99
R8891:Pcdhb14 UTSW 18 37,582,692 (GRCm39) missense probably damaging 1.00
R8992:Pcdhb14 UTSW 18 37,582,231 (GRCm39) missense probably damaging 1.00
R9043:Pcdhb14 UTSW 18 37,581,851 (GRCm39) missense probably damaging 0.98
R9069:Pcdhb14 UTSW 18 37,583,157 (GRCm39) nonsense probably null
R9127:Pcdhb14 UTSW 18 37,582,091 (GRCm39) missense probably damaging 0.99
R9345:Pcdhb14 UTSW 18 37,581,281 (GRCm39) missense probably damaging 0.98
R9470:Pcdhb14 UTSW 18 37,581,076 (GRCm39) missense probably benign
R9626:Pcdhb14 UTSW 18 37,581,787 (GRCm39) missense probably damaging 1.00
R9758:Pcdhb14 UTSW 18 37,582,040 (GRCm39) missense probably benign 0.08
X0065:Pcdhb14 UTSW 18 37,583,037 (GRCm39) nonsense probably null
X0065:Pcdhb14 UTSW 18 37,582,474 (GRCm39) missense possibly damaging 0.95
Z1177:Pcdhb14 UTSW 18 37,582,907 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTCACACTGCATGTATTGC -3'
(R):5'- CCCTAAAATTGGAATTCTCCTCCG -3'

Sequencing Primer
(F):5'- GGTCGATGGTTTCTCTCAGCC -3'
(R):5'- AAAATTGGAATTCTCCTCCGTGTTTC -3'
Posted On 2020-07-28