Incidental Mutation 'R8305:Sptbn2'
ID 641036
Institutional Source Beutler Lab
Gene Symbol Sptbn2
Ensembl Gene ENSMUSG00000067889
Gene Name spectrin beta, non-erythrocytic 2
Synonyms Spnb3
MMRRC Submission 067716-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8305 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 4761195-4802388 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 4779158 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 281 (S281T)
Ref Sequence ENSEMBL: ENSMUSP00000008991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008991]
AlphaFold Q68FG2
Predicted Effect possibly damaging
Transcript: ENSMUST00000008991
AA Change: S281T

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000008991
Gene: ENSMUSG00000067889
AA Change: S281T

DomainStartEndE-ValueType
CH 59 159 1.86e-28 SMART
CH 178 276 2.86e-20 SMART
SPEC 308 414 4.63e-1 SMART
SPEC 428 528 3.07e-23 SMART
SPEC 534 638 4.47e-25 SMART
SPEC 644 744 1.28e-25 SMART
SPEC 750 849 4.98e-23 SMART
SPEC 855 955 1.63e-18 SMART
SPEC 961 1062 1.45e-24 SMART
SPEC 1068 1169 4.15e-20 SMART
SPEC 1175 1275 5.26e-22 SMART
SPEC 1281 1380 1.17e-19 SMART
SPEC 1386 1485 2.06e-24 SMART
SPEC 1491 1585 1.74e-22 SMART
SPEC 1591 1691 5.42e-24 SMART
SPEC 1697 1798 2.1e-21 SMART
SPEC 1804 1904 5.47e-20 SMART
SPEC 1910 2010 1.99e-22 SMART
SPEC 2016 2256 2.92e-6 SMART
PH 2219 2330 1.65e-14 SMART
low complexity region 2373 2386 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous hypomorphic mutants exhibit a progressive ataxic phenotype with gait abnormalities, tremor, deteriorating motor coordination, Purkinje cell loss, and cerebellar atrophy (molecular layer thinning) and age-related reduction in simple firing ratein surviving Purkinje cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 64,208,844 (GRCm39) E243K possibly damaging Het
Accsl A T 2: 93,696,423 (GRCm39) H58Q probably benign Het
Actl7a T A 4: 56,743,744 (GRCm39) F90L probably benign Het
Adam5 G A 8: 25,300,719 (GRCm39) A270V possibly damaging Het
Angptl3 A G 4: 98,919,548 (GRCm39) T103A probably damaging Het
Ankhd1 T C 18: 36,780,219 (GRCm39) L1757P possibly damaging Het
Apoa4 T A 9: 46,152,453 (GRCm39) M1K probably null Het
Arih1 T A 9: 59,303,770 (GRCm39) Q445L probably benign Het
Asb14 A T 14: 26,634,054 (GRCm39) I420L probably benign Het
Bbs2 A C 8: 94,800,953 (GRCm39) V626G probably damaging Het
Cep290 C A 10: 100,380,796 (GRCm39) A1678D probably benign Het
Cilp G A 9: 65,186,286 (GRCm39) G794S probably damaging Het
Clca3a1 C T 3: 144,464,927 (GRCm39) probably benign Het
Clca3b T A 3: 144,531,698 (GRCm39) N702I probably damaging Het
Col24a1 T C 3: 145,179,937 (GRCm39) V1143A probably benign Het
Cux1 T C 5: 136,388,863 (GRCm39) T223A probably benign Het
Defa30 A T 8: 21,625,475 (GRCm39) T80S probably benign Het
Dennd1a G A 2: 37,748,093 (GRCm39) L375F probably damaging Het
Dnajc6 C T 4: 101,480,984 (GRCm39) T675I probably damaging Het
Emc9 A G 14: 55,822,556 (GRCm39) V4A probably damaging Het
Enpp3 C G 10: 24,700,827 (GRCm39) probably null Het
Fam117b A G 1: 59,952,782 (GRCm39) T154A probably benign Het
Filip1 G T 9: 79,727,757 (GRCm39) Y287* probably null Het
Flt3 T C 5: 147,284,864 (GRCm39) D751G probably damaging Het
Frem1 T A 4: 82,918,226 (GRCm39) Q572L probably benign Het
Gja10 G A 4: 32,602,441 (GRCm39) probably benign Het
Gm39115 A G 7: 141,689,360 (GRCm39) C138R unknown Het
Gm7356 T A 17: 14,221,699 (GRCm39) Y110F probably benign Het
Igf2r T C 17: 12,952,747 (GRCm39) K233R probably benign Het
Igkv9-129 A T 6: 67,817,206 (GRCm39) E103D probably benign Het
Igsf11 C A 16: 38,827,586 (GRCm39) T48N probably damaging Het
Itpkc A T 7: 26,913,944 (GRCm39) Y506N probably damaging Het
Kat2a A C 11: 100,600,304 (GRCm39) M357R possibly damaging Het
Kbtbd12 T C 6: 88,595,132 (GRCm39) R233G possibly damaging Het
Kcnd2 T A 6: 21,726,197 (GRCm39) C563* probably null Het
Kcnu1 T C 8: 26,382,018 (GRCm39) V456A probably benign Het
Kif24 A G 4: 41,428,825 (GRCm39) V45A probably damaging Het
Macf1 A T 4: 123,289,414 (GRCm39) probably benign Het
Map3k19 T A 1: 127,745,007 (GRCm39) E1177D Het
Mdn1 G T 4: 32,725,107 (GRCm39) L2575F probably benign Het
Mga T A 2: 119,776,800 (GRCm39) M1569K possibly damaging Het
Mvk T C 5: 114,588,840 (GRCm39) Y161H probably damaging Het
Or10al3 T A 17: 38,012,389 (GRCm39) M276K probably benign Het
Or14c44 G T 7: 86,061,987 (GRCm39) C139F probably damaging Het
Or2n1 C A 17: 38,486,464 (GRCm39) T163K probably damaging Het
Pcdhb14 T A 18: 37,583,075 (GRCm39) V727E possibly damaging Het
Pcsk7 T G 9: 45,821,707 (GRCm39) V167G probably damaging Het
Plin5 T C 17: 56,422,221 (GRCm39) D146G probably benign Het
Plxna4 C T 6: 32,188,000 (GRCm39) G879R possibly damaging Het
Prss58 C T 6: 40,872,594 (GRCm39) A171T probably benign Het
Pum1 A G 4: 130,499,231 (GRCm39) I1016V probably benign Het
Rbm43 A G 2: 51,816,712 (GRCm39) V85A probably damaging Het
Rdh16f2 T A 10: 127,712,864 (GRCm39) D287E probably damaging Het
Rptor T A 11: 119,702,812 (GRCm39) L393Q probably damaging Het
Sbf2 T G 7: 109,970,825 (GRCm39) H857P possibly damaging Het
Scn8a A C 15: 100,938,387 (GRCm39) T1919P probably benign Het
Sema6b C T 17: 56,434,084 (GRCm39) G377E probably damaging Het
Senp7 T A 16: 55,975,603 (GRCm39) D436E probably damaging Het
Slc6a17 T A 3: 107,380,901 (GRCm39) I535F probably benign Het
Stt3b T C 9: 115,083,999 (GRCm39) I392M probably damaging Het
Tfap2b T C 1: 19,296,660 (GRCm39) V201A possibly damaging Het
Timm10b T C 7: 105,289,876 (GRCm39) probably benign Het
Ttc23 A C 7: 67,312,135 (GRCm39) D14A probably damaging Het
Usp32 A T 11: 84,923,011 (GRCm39) L636I possibly damaging Het
Vgll4 G T 6: 114,867,613 (GRCm39) H79Q probably damaging Het
Vps13d A G 4: 144,818,858 (GRCm39) I3047T Het
Zan T C 5: 137,448,813 (GRCm39) E1680G unknown Het
Other mutations in Sptbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Sptbn2 APN 19 4,774,733 (GRCm39) missense possibly damaging 0.94
IGL00688:Sptbn2 APN 19 4,775,966 (GRCm39) missense probably damaging 1.00
IGL01339:Sptbn2 APN 19 4,796,000 (GRCm39) nonsense probably null
IGL01373:Sptbn2 APN 19 4,796,000 (GRCm39) nonsense probably null
IGL01420:Sptbn2 APN 19 4,784,153 (GRCm39) missense probably benign
IGL01456:Sptbn2 APN 19 4,796,777 (GRCm39) missense probably damaging 1.00
IGL01953:Sptbn2 APN 19 4,799,721 (GRCm39) missense probably benign
IGL03026:Sptbn2 APN 19 4,774,261 (GRCm39) critical splice donor site probably null
IGL03275:Sptbn2 APN 19 4,782,689 (GRCm39) missense possibly damaging 0.65
IGL03286:Sptbn2 APN 19 4,797,860 (GRCm39) missense probably damaging 0.97
F5770:Sptbn2 UTSW 19 4,800,660 (GRCm39) missense probably damaging 1.00
PIT4696001:Sptbn2 UTSW 19 4,795,605 (GRCm39) missense probably benign 0.00
R0046:Sptbn2 UTSW 19 4,795,405 (GRCm39) intron probably benign
R0046:Sptbn2 UTSW 19 4,795,405 (GRCm39) intron probably benign
R0121:Sptbn2 UTSW 19 4,795,321 (GRCm39) missense probably damaging 1.00
R0127:Sptbn2 UTSW 19 4,774,772 (GRCm39) missense probably damaging 1.00
R0212:Sptbn2 UTSW 19 4,796,970 (GRCm39) critical splice donor site probably null
R0277:Sptbn2 UTSW 19 4,795,173 (GRCm39) missense probably benign 0.28
R0417:Sptbn2 UTSW 19 4,787,954 (GRCm39) missense probably benign 0.01
R0457:Sptbn2 UTSW 19 4,795,966 (GRCm39) missense possibly damaging 0.89
R0536:Sptbn2 UTSW 19 4,776,718 (GRCm39) missense probably damaging 0.99
R0631:Sptbn2 UTSW 19 4,790,014 (GRCm39) missense probably benign 0.01
R0734:Sptbn2 UTSW 19 4,798,151 (GRCm39) nonsense probably null
R0742:Sptbn2 UTSW 19 4,769,011 (GRCm39) missense possibly damaging 0.46
R1195:Sptbn2 UTSW 19 4,795,921 (GRCm39) missense possibly damaging 0.85
R1195:Sptbn2 UTSW 19 4,795,921 (GRCm39) missense possibly damaging 0.85
R1195:Sptbn2 UTSW 19 4,795,921 (GRCm39) missense possibly damaging 0.85
R1364:Sptbn2 UTSW 19 4,782,693 (GRCm39) missense probably damaging 1.00
R1495:Sptbn2 UTSW 19 4,769,004 (GRCm39) missense possibly damaging 0.92
R1498:Sptbn2 UTSW 19 4,794,274 (GRCm39) missense possibly damaging 0.94
R1606:Sptbn2 UTSW 19 4,800,270 (GRCm39) critical splice donor site probably null
R1678:Sptbn2 UTSW 19 4,800,525 (GRCm39) missense probably damaging 1.00
R1746:Sptbn2 UTSW 19 4,795,992 (GRCm39) nonsense probably null
R1820:Sptbn2 UTSW 19 4,776,624 (GRCm39) missense probably damaging 0.98
R1830:Sptbn2 UTSW 19 4,782,569 (GRCm39) missense probably benign 0.09
R1863:Sptbn2 UTSW 19 4,782,713 (GRCm39) missense possibly damaging 0.54
R1967:Sptbn2 UTSW 19 4,795,327 (GRCm39) missense probably benign 0.00
R2085:Sptbn2 UTSW 19 4,788,587 (GRCm39) missense probably benign 0.09
R2301:Sptbn2 UTSW 19 4,784,166 (GRCm39) missense probably benign 0.00
R2310:Sptbn2 UTSW 19 4,768,963 (GRCm39) missense probably benign 0.19
R2888:Sptbn2 UTSW 19 4,798,664 (GRCm39) missense possibly damaging 0.52
R3788:Sptbn2 UTSW 19 4,795,950 (GRCm39) missense probably damaging 1.00
R4429:Sptbn2 UTSW 19 4,788,383 (GRCm39) missense probably damaging 1.00
R4536:Sptbn2 UTSW 19 4,782,630 (GRCm39) missense probably damaging 1.00
R4662:Sptbn2 UTSW 19 4,789,267 (GRCm39) missense probably damaging 1.00
R4672:Sptbn2 UTSW 19 4,782,524 (GRCm39) missense probably benign 0.25
R4731:Sptbn2 UTSW 19 4,792,508 (GRCm39) missense probably damaging 0.96
R4747:Sptbn2 UTSW 19 4,798,182 (GRCm39) missense probably benign 0.27
R4889:Sptbn2 UTSW 19 4,779,458 (GRCm39) missense possibly damaging 0.69
R4891:Sptbn2 UTSW 19 4,788,497 (GRCm39) missense probably damaging 1.00
R4965:Sptbn2 UTSW 19 4,779,337 (GRCm39) missense probably benign 0.13
R4968:Sptbn2 UTSW 19 4,779,230 (GRCm39) splice site probably null
R4981:Sptbn2 UTSW 19 4,801,686 (GRCm39) missense probably benign 0.22
R5159:Sptbn2 UTSW 19 4,787,885 (GRCm39) missense probably benign 0.12
R5202:Sptbn2 UTSW 19 4,774,212 (GRCm39) missense probably damaging 1.00
R5253:Sptbn2 UTSW 19 4,800,110 (GRCm39) missense probably benign 0.01
R5294:Sptbn2 UTSW 19 4,768,936 (GRCm39) missense possibly damaging 0.67
R5465:Sptbn2 UTSW 19 4,800,133 (GRCm39) missense probably benign 0.00
R5546:Sptbn2 UTSW 19 4,775,978 (GRCm39) missense probably damaging 1.00
R5593:Sptbn2 UTSW 19 4,798,975 (GRCm39) missense probably damaging 1.00
R5780:Sptbn2 UTSW 19 4,774,695 (GRCm39) missense probably damaging 1.00
R5835:Sptbn2 UTSW 19 4,788,247 (GRCm39) missense probably damaging 1.00
R6008:Sptbn2 UTSW 19 4,789,306 (GRCm39) missense possibly damaging 0.89
R6108:Sptbn2 UTSW 19 4,781,420 (GRCm39) critical splice donor site probably null
R6236:Sptbn2 UTSW 19 4,798,166 (GRCm39) missense probably benign 0.01
R6307:Sptbn2 UTSW 19 4,774,674 (GRCm39) missense probably damaging 1.00
R6383:Sptbn2 UTSW 19 4,782,524 (GRCm39) missense possibly damaging 0.89
R6397:Sptbn2 UTSW 19 4,792,446 (GRCm39) missense possibly damaging 0.91
R6453:Sptbn2 UTSW 19 4,794,208 (GRCm39) missense possibly damaging 0.67
R6561:Sptbn2 UTSW 19 4,797,954 (GRCm39) missense probably benign 0.39
R6564:Sptbn2 UTSW 19 4,782,052 (GRCm39) missense probably damaging 1.00
R6644:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R6703:Sptbn2 UTSW 19 4,799,843 (GRCm39) missense probably benign
R6703:Sptbn2 UTSW 19 4,799,842 (GRCm39) missense probably benign
R6753:Sptbn2 UTSW 19 4,797,813 (GRCm39) missense probably benign 0.01
R7007:Sptbn2 UTSW 19 4,794,173 (GRCm39) missense possibly damaging 0.82
R7131:Sptbn2 UTSW 19 4,799,488 (GRCm39) missense probably null
R7219:Sptbn2 UTSW 19 4,774,201 (GRCm39) missense probably damaging 1.00
R7285:Sptbn2 UTSW 19 4,787,471 (GRCm39) missense probably benign 0.00
R7308:Sptbn2 UTSW 19 4,801,602 (GRCm39) missense probably benign
R7469:Sptbn2 UTSW 19 4,795,146 (GRCm39) missense probably benign 0.00
R7502:Sptbn2 UTSW 19 4,798,110 (GRCm39) missense probably benign 0.02
R7623:Sptbn2 UTSW 19 4,776,196 (GRCm39) missense probably damaging 1.00
R7635:Sptbn2 UTSW 19 4,794,235 (GRCm39) missense probably damaging 1.00
R7733:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7738:Sptbn2 UTSW 19 4,774,153 (GRCm39) missense probably damaging 1.00
R7742:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7767:Sptbn2 UTSW 19 4,784,171 (GRCm39) missense possibly damaging 0.62
R7795:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7796:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7871:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7877:Sptbn2 UTSW 19 4,794,290 (GRCm39) missense possibly damaging 0.93
R7920:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7921:Sptbn2 UTSW 19 4,799,040 (GRCm39) missense probably benign 0.05
R7923:Sptbn2 UTSW 19 4,796,827 (GRCm39) missense probably benign 0.01
R8137:Sptbn2 UTSW 19 4,787,431 (GRCm39) missense possibly damaging 0.81
R8695:Sptbn2 UTSW 19 4,796,724 (GRCm39) missense possibly damaging 0.86
R8790:Sptbn2 UTSW 19 4,782,052 (GRCm39) missense probably damaging 1.00
R9125:Sptbn2 UTSW 19 4,784,241 (GRCm39) missense probably benign 0.04
R9483:Sptbn2 UTSW 19 4,789,974 (GRCm39) missense probably damaging 1.00
R9620:Sptbn2 UTSW 19 4,800,535 (GRCm39) missense probably damaging 0.99
R9631:Sptbn2 UTSW 19 4,788,218 (GRCm39) missense probably damaging 1.00
R9646:Sptbn2 UTSW 19 4,795,341 (GRCm39) missense probably damaging 1.00
R9694:Sptbn2 UTSW 19 4,800,535 (GRCm39) missense probably damaging 0.99
V7580:Sptbn2 UTSW 19 4,800,660 (GRCm39) missense probably damaging 1.00
Z1176:Sptbn2 UTSW 19 4,795,219 (GRCm39) missense probably benign 0.01
Z1176:Sptbn2 UTSW 19 4,788,233 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGAGAAGATGTGTTAGCC -3'
(R):5'- AGGCCAGGGACTCGTATTTC -3'

Sequencing Primer
(F):5'- AGAAGATGTGTTAGCCTTGGAG -3'
(R):5'- AGGGACTCGTATTTCTCTACCAGG -3'
Posted On 2020-07-28