Incidental Mutation 'R8306:Zdbf2'
ID 641038
Institutional Source Beutler Lab
Gene Symbol Zdbf2
Ensembl Gene ENSMUSG00000027520
Gene Name zinc finger, DBF-type containing 2
Synonyms 4930431J08Rik, 9330107J05Rik
MMRRC Submission 067792-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R8306 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 63312424-63353735 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 63343234 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 538 (C538S)
Ref Sequence ENSEMBL: ENSMUSP00000029025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]
AlphaFold Q5SS00
Predicted Effect possibly damaging
Transcript: ENSMUST00000029025
AA Change: C538S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: C538S

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114132
AA Change: C538S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: C538S

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 C A 11: 101,302,194 (GRCm39) V158F probably damaging Het
Abtb3 T A 10: 85,434,409 (GRCm39) C22* probably null Het
Adam1b T C 5: 121,641,212 (GRCm39) probably benign Het
Ambn G A 5: 88,607,281 (GRCm39) E50K possibly damaging Het
Ash1l A G 3: 88,873,259 (GRCm39) D14G probably benign Het
Asphd1 C T 7: 126,547,784 (GRCm39) R173H probably damaging Het
Atr A T 9: 95,802,423 (GRCm39) T1772S Het
Best3 T C 10: 116,838,515 (GRCm39) L191P probably damaging Het
Bola1 A T 3: 96,104,517 (GRCm39) S26T probably benign Het
Borcs6 T C 11: 68,950,646 (GRCm39) L8P probably benign Het
Brca1 T G 11: 101,416,463 (GRCm39) Q557P probably damaging Het
Brca2 G A 5: 150,460,128 (GRCm39) E468K possibly damaging Het
Capza2 T A 6: 17,637,131 (GRCm39) L4Q probably benign Het
Cc2d2b T A 19: 40,804,228 (GRCm39) Y918* probably null Het
Ccdc163 T C 4: 116,567,472 (GRCm39) L67P probably damaging Het
Ccdc172 C A 19: 58,525,022 (GRCm39) Q160K probably damaging Het
Ccp110 T A 7: 118,321,903 (GRCm39) D519E probably benign Het
Cd300ld2 T C 11: 114,904,648 (GRCm39) Q73R probably benign Het
Cfap46 T A 7: 139,236,496 (GRCm39) D608V Het
Cfap69 T G 5: 5,654,287 (GRCm39) Y549S probably benign Het
Cilp G A 9: 65,186,286 (GRCm39) G794S probably damaging Het
Clu A C 14: 66,217,211 (GRCm39) Q348P probably damaging Het
Cnot1 A T 8: 96,473,649 (GRCm39) N1153K probably benign Het
Col2a1 T C 15: 97,888,849 (GRCm39) probably null Het
Col6a6 A T 9: 105,661,272 (GRCm39) I279N probably damaging Het
Dop1a A G 9: 86,402,259 (GRCm39) D1153G possibly damaging Het
Dpyd A G 3: 119,205,822 (GRCm39) K888E probably benign Het
Eif2ak4 T C 2: 118,287,656 (GRCm39) I1208T possibly damaging Het
Epha1 T C 6: 42,335,722 (GRCm39) I972V probably damaging Het
Fam13c C T 10: 70,388,983 (GRCm39) T503I probably benign Het
Fbxo43 T A 15: 36,162,013 (GRCm39) Q398L probably benign Het
Fbxo44 A G 4: 148,243,089 (GRCm39) I57T probably benign Het
Flnc T C 6: 29,449,369 (GRCm39) I1422T probably benign Het
Flrt2 T C 12: 95,746,076 (GRCm39) L138P probably damaging Het
Frem3 A G 8: 81,338,840 (GRCm39) K378E possibly damaging Het
Ganc T A 2: 120,252,560 (GRCm39) D128E probably benign Het
Gm19965 T C 1: 116,749,515 (GRCm39) S399P Het
H2-Q1 A T 17: 35,539,997 (GRCm39) K89* probably null Het
H2-Q2 A T 17: 35,561,301 (GRCm39) probably benign Het
Hmmr G A 11: 40,612,499 (GRCm39) S206F probably damaging Het
Homer2 T A 7: 81,274,014 (GRCm39) S125C possibly damaging Het
Hormad2 T C 11: 4,358,714 (GRCm39) K231R probably benign Het
Kif17 A C 4: 138,005,220 (GRCm39) K262Q probably damaging Het
Kif20a G A 18: 34,761,444 (GRCm39) S279N probably benign Het
Lrp12 T C 15: 39,741,450 (GRCm39) N441D probably damaging Het
Lta4h G T 10: 93,318,126 (GRCm39) L515F possibly damaging Het
Mavs T C 2: 131,088,470 (GRCm39) S425P probably benign Het
Mcat A C 15: 83,439,592 (GRCm39) D99E probably damaging Het
Nav2 C A 7: 49,195,765 (GRCm39) T1047K probably benign Het
Neb T A 2: 52,099,657 (GRCm39) Y4731F probably damaging Het
Nectin4 G C 1: 171,211,325 (GRCm39) R283P probably null Het
Notch3 G A 17: 32,377,086 (GRCm39) T273I probably damaging Het
Or4c11c G A 2: 88,661,633 (GRCm39) M57I possibly damaging Het
Or5i1 A T 2: 87,613,830 (GRCm39) *317C probably null Het
Or6b2b T G 1: 92,419,247 (GRCm39) I77L possibly damaging Het
Or6z7 T A 7: 6,483,868 (GRCm39) I96F possibly damaging Het
Pcdha12 A T 18: 37,155,638 (GRCm39) T786S probably benign Het
Pde9a A G 17: 31,692,186 (GRCm39) K520E probably benign Het
Piezo2 A C 18: 63,208,801 (GRCm39) L1404R probably damaging Het
Rrbp1 T C 2: 143,792,416 (GRCm39) S1321G probably benign Het
Rtkn T C 6: 83,128,897 (GRCm39) V464A probably damaging Het
Rtn4rl1 T C 11: 75,156,147 (GRCm39) F193S probably damaging Het
Samd4 G A 14: 47,122,374 (GRCm39) V33I probably damaging Het
Scn5a A G 9: 119,350,357 (GRCm39) L839P probably damaging Het
Slc6a17 C A 3: 107,380,985 (GRCm39) V507L probably benign Het
Stradb C A 1: 59,030,356 (GRCm39) N203K unknown Het
Tenm2 T C 11: 35,960,196 (GRCm39) T1044A possibly damaging Het
Tmem245 A C 4: 56,886,037 (GRCm39) W860G probably damaging Het
Tpst2 G A 5: 112,455,803 (GRCm39) R114H probably damaging Het
Trappc10 C T 10: 78,036,460 (GRCm39) D920N possibly damaging Het
Vmn1r59 T A 7: 5,456,966 (GRCm39) I265L probably benign Het
Zbtb20 A C 16: 43,439,100 (GRCm39) D667A probably damaging Het
Zbtb4 T A 11: 69,668,309 (GRCm39) I344N probably damaging Het
Zmym6 A T 4: 127,016,355 (GRCm39) H712L probably damaging Het
Other mutations in Zdbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Zdbf2 APN 1 63,345,673 (GRCm39) missense possibly damaging 0.92
IGL00796:Zdbf2 APN 1 63,346,364 (GRCm39) missense probably benign 0.04
IGL00801:Zdbf2 APN 1 63,342,197 (GRCm39) missense possibly damaging 0.66
IGL02803:Zdbf2 APN 1 63,342,236 (GRCm39) missense possibly damaging 0.46
R0143:Zdbf2 UTSW 1 63,347,233 (GRCm39) missense probably benign 0.01
R0147:Zdbf2 UTSW 1 63,343,165 (GRCm39) nonsense probably null
R0148:Zdbf2 UTSW 1 63,343,165 (GRCm39) nonsense probably null
R0433:Zdbf2 UTSW 1 63,345,302 (GRCm39) missense possibly damaging 0.46
R0502:Zdbf2 UTSW 1 63,344,449 (GRCm39) missense possibly damaging 0.66
R0645:Zdbf2 UTSW 1 63,344,109 (GRCm39) missense possibly damaging 0.81
R0765:Zdbf2 UTSW 1 63,344,882 (GRCm39) missense possibly damaging 0.46
R1068:Zdbf2 UTSW 1 63,342,589 (GRCm39) missense possibly damaging 0.94
R1216:Zdbf2 UTSW 1 63,342,161 (GRCm39) missense possibly damaging 0.83
R1235:Zdbf2 UTSW 1 63,348,232 (GRCm39) missense possibly damaging 0.66
R1352:Zdbf2 UTSW 1 63,342,212 (GRCm39) missense probably damaging 0.96
R1402:Zdbf2 UTSW 1 63,342,786 (GRCm39) missense possibly damaging 0.46
R1402:Zdbf2 UTSW 1 63,342,786 (GRCm39) missense possibly damaging 0.46
R1435:Zdbf2 UTSW 1 63,342,199 (GRCm39) missense possibly damaging 0.66
R1562:Zdbf2 UTSW 1 63,342,747 (GRCm39) missense possibly damaging 0.83
R1624:Zdbf2 UTSW 1 63,343,018 (GRCm39) missense possibly damaging 0.66
R1635:Zdbf2 UTSW 1 63,343,493 (GRCm39) missense possibly damaging 0.92
R1644:Zdbf2 UTSW 1 63,348,131 (GRCm39) missense possibly damaging 0.66
R1662:Zdbf2 UTSW 1 63,343,408 (GRCm39) nonsense probably null
R1700:Zdbf2 UTSW 1 63,341,900 (GRCm39) missense unknown
R1720:Zdbf2 UTSW 1 63,342,436 (GRCm39) missense possibly damaging 0.46
R1853:Zdbf2 UTSW 1 63,344,701 (GRCm39) frame shift probably null
R1854:Zdbf2 UTSW 1 63,344,701 (GRCm39) frame shift probably null
R1973:Zdbf2 UTSW 1 63,348,860 (GRCm39) missense unknown
R2336:Zdbf2 UTSW 1 63,342,623 (GRCm39) missense probably benign 0.00
R2428:Zdbf2 UTSW 1 63,344,774 (GRCm39) missense probably benign 0.04
R3010:Zdbf2 UTSW 1 63,342,224 (GRCm39) missense possibly damaging 0.92
R3034:Zdbf2 UTSW 1 63,343,364 (GRCm39) missense probably damaging 0.96
R3079:Zdbf2 UTSW 1 63,346,636 (GRCm39) missense probably benign 0.05
R3196:Zdbf2 UTSW 1 63,347,579 (GRCm39) missense possibly damaging 0.46
R3711:Zdbf2 UTSW 1 63,347,830 (GRCm39) missense possibly damaging 0.83
R3845:Zdbf2 UTSW 1 63,347,483 (GRCm39) missense possibly damaging 0.66
R4093:Zdbf2 UTSW 1 63,348,940 (GRCm39) missense possibly damaging 0.83
R4250:Zdbf2 UTSW 1 63,342,020 (GRCm39) missense possibly damaging 0.46
R4592:Zdbf2 UTSW 1 63,345,750 (GRCm39) missense possibly damaging 0.82
R4721:Zdbf2 UTSW 1 63,347,951 (GRCm39) missense possibly damaging 0.46
R4779:Zdbf2 UTSW 1 63,342,397 (GRCm39) missense possibly damaging 0.66
R4928:Zdbf2 UTSW 1 63,347,973 (GRCm39) missense possibly damaging 0.81
R4943:Zdbf2 UTSW 1 63,342,073 (GRCm39) missense possibly damaging 0.92
R5025:Zdbf2 UTSW 1 63,342,809 (GRCm39) missense possibly damaging 0.82
R5095:Zdbf2 UTSW 1 63,348,232 (GRCm39) missense possibly damaging 0.66
R5149:Zdbf2 UTSW 1 63,344,062 (GRCm39) missense possibly damaging 0.83
R5326:Zdbf2 UTSW 1 63,343,570 (GRCm39) missense possibly damaging 0.66
R5341:Zdbf2 UTSW 1 63,347,092 (GRCm39) missense probably benign 0.27
R5511:Zdbf2 UTSW 1 63,344,836 (GRCm39) missense probably benign 0.03
R5809:Zdbf2 UTSW 1 63,345,035 (GRCm39) missense possibly damaging 0.90
R5902:Zdbf2 UTSW 1 63,345,685 (GRCm39) missense possibly damaging 0.83
R6162:Zdbf2 UTSW 1 63,319,977 (GRCm39) start gained probably benign
R6245:Zdbf2 UTSW 1 63,343,592 (GRCm39) missense possibly damaging 0.46
R6332:Zdbf2 UTSW 1 63,346,981 (GRCm39) missense possibly damaging 0.66
R6361:Zdbf2 UTSW 1 63,342,480 (GRCm39) missense possibly damaging 0.66
R6489:Zdbf2 UTSW 1 63,346,637 (GRCm39) missense possibly damaging 0.46
R6517:Zdbf2 UTSW 1 63,344,679 (GRCm39) missense possibly damaging 0.81
R6624:Zdbf2 UTSW 1 63,343,073 (GRCm39) missense possibly damaging 0.46
R6643:Zdbf2 UTSW 1 63,343,667 (GRCm39) missense possibly damaging 0.82
R6786:Zdbf2 UTSW 1 63,343,679 (GRCm39) missense possibly damaging 0.46
R6808:Zdbf2 UTSW 1 63,347,687 (GRCm39) missense possibly damaging 0.66
R6896:Zdbf2 UTSW 1 63,348,031 (GRCm39) missense probably damaging 0.98
R6997:Zdbf2 UTSW 1 63,329,925 (GRCm39) missense probably benign 0.09
R7011:Zdbf2 UTSW 1 63,345,925 (GRCm39) missense possibly damaging 0.66
R7058:Zdbf2 UTSW 1 63,346,563 (GRCm39) missense possibly damaging 0.66
R7066:Zdbf2 UTSW 1 63,346,718 (GRCm39) missense probably benign
R7177:Zdbf2 UTSW 1 63,334,120 (GRCm39) missense possibly damaging 0.94
R7184:Zdbf2 UTSW 1 63,345,664 (GRCm39) missense possibly damaging 0.92
R7273:Zdbf2 UTSW 1 63,342,563 (GRCm39) missense possibly damaging 0.90
R7387:Zdbf2 UTSW 1 63,343,198 (GRCm39) missense possibly damaging 0.46
R7468:Zdbf2 UTSW 1 63,346,669 (GRCm39) missense probably benign
R7695:Zdbf2 UTSW 1 63,346,529 (GRCm39) missense possibly damaging 0.83
R7712:Zdbf2 UTSW 1 63,344,530 (GRCm39) missense possibly damaging 0.83
R7735:Zdbf2 UTSW 1 63,343,264 (GRCm39) missense possibly damaging 0.66
R7736:Zdbf2 UTSW 1 63,347,166 (GRCm39) nonsense probably null
R7759:Zdbf2 UTSW 1 63,347,535 (GRCm39) missense possibly damaging 0.46
R7796:Zdbf2 UTSW 1 63,342,583 (GRCm39) missense possibly damaging 0.90
R7908:Zdbf2 UTSW 1 63,345,986 (GRCm39) missense possibly damaging 0.46
R7970:Zdbf2 UTSW 1 63,343,330 (GRCm39) missense possibly damaging 0.92
R8076:Zdbf2 UTSW 1 63,345,260 (GRCm39) missense possibly damaging 0.92
R8152:Zdbf2 UTSW 1 63,345,572 (GRCm39) missense possibly damaging 0.92
R8195:Zdbf2 UTSW 1 63,343,225 (GRCm39) missense possibly damaging 0.83
R8272:Zdbf2 UTSW 1 63,345,142 (GRCm39) missense probably benign
R8309:Zdbf2 UTSW 1 63,345,750 (GRCm39) missense possibly damaging 0.82
R8323:Zdbf2 UTSW 1 63,342,073 (GRCm39) missense possibly damaging 0.46
R8400:Zdbf2 UTSW 1 63,344,135 (GRCm39) missense possibly damaging 0.92
R8443:Zdbf2 UTSW 1 63,345,166 (GRCm39) missense possibly damaging 0.83
R8460:Zdbf2 UTSW 1 63,348,729 (GRCm39) small deletion probably benign
R8528:Zdbf2 UTSW 1 63,342,545 (GRCm39) missense possibly damaging 0.82
R8812:Zdbf2 UTSW 1 63,347,272 (GRCm39) missense probably benign 0.00
R8962:Zdbf2 UTSW 1 63,347,162 (GRCm39) missense probably benign 0.00
R9061:Zdbf2 UTSW 1 63,346,296 (GRCm39) missense
R9072:Zdbf2 UTSW 1 63,344,923 (GRCm39) missense possibly damaging 0.83
R9232:Zdbf2 UTSW 1 63,347,168 (GRCm39) missense possibly damaging 0.66
R9257:Zdbf2 UTSW 1 63,345,400 (GRCm39) missense probably damaging 1.00
R9411:Zdbf2 UTSW 1 63,343,288 (GRCm39) missense probably damaging 0.97
R9470:Zdbf2 UTSW 1 63,344,784 (GRCm39) missense possibly damaging 0.82
R9606:Zdbf2 UTSW 1 63,342,536 (GRCm39) missense possibly damaging 0.92
R9621:Zdbf2 UTSW 1 63,342,635 (GRCm39) missense possibly damaging 0.66
RF021:Zdbf2 UTSW 1 63,341,811 (GRCm39) missense possibly damaging 0.82
X0018:Zdbf2 UTSW 1 63,344,510 (GRCm39) missense possibly damaging 0.92
X0027:Zdbf2 UTSW 1 63,347,166 (GRCm39) nonsense probably null
X0057:Zdbf2 UTSW 1 63,344,549 (GRCm39) missense possibly damaging 0.66
X0063:Zdbf2 UTSW 1 63,344,696 (GRCm39) missense probably benign 0.04
Z1176:Zdbf2 UTSW 1 63,343,404 (GRCm39) missense possibly damaging 0.83
Z1177:Zdbf2 UTSW 1 63,348,362 (GRCm39) missense unknown
Z1177:Zdbf2 UTSW 1 63,343,245 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CACTGTTTCTGGAGCAACTTC -3'
(R):5'- GCTTCCTTCTTGAACAGGCAC -3'

Sequencing Primer
(F):5'- AGCAGTTCTCGTCAGGTGATTACAC -3'
(R):5'- AGGCACCTGGGGATGGTC -3'
Posted On 2020-07-28