Incidental Mutation 'R8306:Zdbf2'
ID 641038
Institutional Source Beutler Lab
Gene Symbol Zdbf2
Ensembl Gene ENSMUSG00000027520
Gene Name zinc finger, DBF-type containing 2
Synonyms 4930431J08Rik, 9330107J05Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.106) question?
Stock # R8306 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 63273265-63314576 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 63304075 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 538 (C538S)
Ref Sequence ENSEMBL: ENSMUSP00000029025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]
AlphaFold Q5SS00
Predicted Effect possibly damaging
Transcript: ENSMUST00000029025
AA Change: C538S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: C538S

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114132
AA Change: C538S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: C538S

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 C A 11: 101,411,368 V158F probably damaging Het
Adam1b T C 5: 121,503,149 probably benign Het
Ambn G A 5: 88,459,422 E50K possibly damaging Het
Ash1l A G 3: 88,965,952 D14G probably benign Het
Asphd1 C T 7: 126,948,612 R173H probably damaging Het
Atr A T 9: 95,920,370 T1772S Het
Best3 T C 10: 117,002,610 L191P probably damaging Het
Bola1 A T 3: 96,197,201 S26T probably benign Het
Borcs6 T C 11: 69,059,820 L8P probably benign Het
Brca1 T G 11: 101,525,637 Q557P probably damaging Het
Brca2 G A 5: 150,536,663 E468K possibly damaging Het
Btbd11 T A 10: 85,598,545 C22* probably null Het
Capza2 T A 6: 17,637,132 L4Q probably benign Het
Cc2d2b T A 19: 40,815,784 Y918* probably null Het
Ccdc163 T C 4: 116,710,275 L67P probably damaging Het
Ccdc172 C A 19: 58,536,590 Q160K probably damaging Het
Ccp110 T A 7: 118,722,680 D519E probably benign Het
Cd300ld2 T C 11: 115,013,822 Q73R probably benign Het
Cfap46 T A 7: 139,656,580 D608V Het
Cfap69 T G 5: 5,604,287 Y549S probably benign Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Clu A C 14: 65,979,762 Q348P probably damaging Het
Cnot1 A T 8: 95,747,021 N1153K probably benign Het
Col2a1 T C 15: 97,990,968 probably null Het
Col6a6 A T 9: 105,784,073 I279N probably damaging Het
Dopey1 A G 9: 86,520,206 D1153G possibly damaging Het
Dpyd A G 3: 119,412,173 K888E probably benign Het
Eif2ak4 T C 2: 118,457,175 I1208T possibly damaging Het
Epha1 T C 6: 42,358,788 I972V probably damaging Het
Fam13c C T 10: 70,553,153 T503I probably benign Het
Fbxo43 T A 15: 36,161,867 Q398L probably benign Het
Fbxo44 A G 4: 148,158,632 I57T probably benign Het
Flnc T C 6: 29,449,370 I1422T probably benign Het
Flrt2 T C 12: 95,779,302 L138P probably damaging Het
Frem3 A G 8: 80,612,211 K378E possibly damaging Het
Ganc T A 2: 120,422,079 D128E probably benign Het
Gm19965 T C 1: 116,821,785 S399P Het
H2-Q1 A T 17: 35,321,021 K89* probably null Het
H2-Q2 A T 17: 35,342,325 probably benign Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Homer2 T A 7: 81,624,266 S125C possibly damaging Het
Hormad2 T C 11: 4,408,714 K231R probably benign Het
Kif17 A C 4: 138,277,909 K262Q probably damaging Het
Kif20a G A 18: 34,628,391 S279N probably benign Het
Lrp12 T C 15: 39,878,054 N441D probably damaging Het
Lta4h G T 10: 93,482,264 L515F possibly damaging Het
Mavs T C 2: 131,246,550 S425P probably benign Het
Mcat A C 15: 83,555,391 D99E probably damaging Het
Nav2 C A 7: 49,546,017 T1047K probably benign Het
Neb T A 2: 52,209,645 Y4731F probably damaging Het
Nectin4 G C 1: 171,383,757 R283P probably null Het
Notch3 G A 17: 32,158,112 T273I probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr1415 T G 1: 92,491,525 I77L possibly damaging Het
Olfr152 A T 2: 87,783,486 *317C probably null Het
Olfr5 T A 7: 6,480,869 I96F possibly damaging Het
Pcdha12 A T 18: 37,022,585 T786S probably benign Het
Pde9a A G 17: 31,473,212 K520E probably benign Het
Piezo2 A C 18: 63,075,730 L1404R probably damaging Het
Rrbp1 T C 2: 143,950,496 S1321G probably benign Het
Rtkn T C 6: 83,151,916 V464A probably damaging Het
Rtn4rl1 T C 11: 75,265,321 F193S probably damaging Het
Samd4 G A 14: 46,884,917 V33I probably damaging Het
Scn5a A G 9: 119,521,291 L839P probably damaging Het
Slc6a17 C A 3: 107,473,669 V507L probably benign Het
Stradb C A 1: 58,991,197 N203K unknown Het
Tenm2 T C 11: 36,069,369 T1044A possibly damaging Het
Tmem245 A C 4: 56,886,037 W860G probably damaging Het
Tpst2 G A 5: 112,307,937 R114H probably damaging Het
Trappc10 C T 10: 78,200,626 D920N possibly damaging Het
Vmn1r59 T A 7: 5,453,967 I265L probably benign Het
Zbtb20 A C 16: 43,618,737 D667A probably damaging Het
Zbtb4 T A 11: 69,777,483 I344N probably damaging Het
Zmym6 A T 4: 127,122,562 H712L probably damaging Het
Other mutations in Zdbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Zdbf2 APN 1 63306514 missense possibly damaging 0.92
IGL00796:Zdbf2 APN 1 63307205 missense probably benign 0.04
IGL00801:Zdbf2 APN 1 63303038 missense possibly damaging 0.66
IGL02803:Zdbf2 APN 1 63303077 missense possibly damaging 0.46
R0143:Zdbf2 UTSW 1 63308074 missense probably benign 0.01
R0147:Zdbf2 UTSW 1 63304006 nonsense probably null
R0148:Zdbf2 UTSW 1 63304006 nonsense probably null
R0433:Zdbf2 UTSW 1 63306143 missense possibly damaging 0.46
R0502:Zdbf2 UTSW 1 63305290 missense possibly damaging 0.66
R0645:Zdbf2 UTSW 1 63304950 missense possibly damaging 0.81
R0765:Zdbf2 UTSW 1 63305723 missense possibly damaging 0.46
R1068:Zdbf2 UTSW 1 63303430 missense possibly damaging 0.94
R1216:Zdbf2 UTSW 1 63303002 missense possibly damaging 0.83
R1235:Zdbf2 UTSW 1 63309073 missense possibly damaging 0.66
R1352:Zdbf2 UTSW 1 63303053 missense probably damaging 0.96
R1402:Zdbf2 UTSW 1 63303627 missense possibly damaging 0.46
R1402:Zdbf2 UTSW 1 63303627 missense possibly damaging 0.46
R1435:Zdbf2 UTSW 1 63303040 missense possibly damaging 0.66
R1562:Zdbf2 UTSW 1 63303588 missense possibly damaging 0.83
R1624:Zdbf2 UTSW 1 63303859 missense possibly damaging 0.66
R1635:Zdbf2 UTSW 1 63304334 missense possibly damaging 0.92
R1644:Zdbf2 UTSW 1 63308972 missense possibly damaging 0.66
R1662:Zdbf2 UTSW 1 63304249 nonsense probably null
R1700:Zdbf2 UTSW 1 63302741 missense unknown
R1720:Zdbf2 UTSW 1 63303277 missense possibly damaging 0.46
R1853:Zdbf2 UTSW 1 63305542 frame shift probably null
R1854:Zdbf2 UTSW 1 63305542 frame shift probably null
R1973:Zdbf2 UTSW 1 63309701 missense unknown
R2336:Zdbf2 UTSW 1 63303464 missense probably benign 0.00
R2428:Zdbf2 UTSW 1 63305615 missense probably benign 0.04
R3010:Zdbf2 UTSW 1 63303065 missense possibly damaging 0.92
R3034:Zdbf2 UTSW 1 63304205 missense probably damaging 0.96
R3079:Zdbf2 UTSW 1 63307477 missense probably benign 0.05
R3196:Zdbf2 UTSW 1 63308420 missense possibly damaging 0.46
R3711:Zdbf2 UTSW 1 63308671 missense possibly damaging 0.83
R3845:Zdbf2 UTSW 1 63308324 missense possibly damaging 0.66
R4093:Zdbf2 UTSW 1 63309781 missense possibly damaging 0.83
R4250:Zdbf2 UTSW 1 63302861 missense possibly damaging 0.46
R4592:Zdbf2 UTSW 1 63306591 missense possibly damaging 0.82
R4721:Zdbf2 UTSW 1 63308792 missense possibly damaging 0.46
R4779:Zdbf2 UTSW 1 63303238 missense possibly damaging 0.66
R4928:Zdbf2 UTSW 1 63308814 missense possibly damaging 0.81
R4943:Zdbf2 UTSW 1 63302914 missense possibly damaging 0.92
R5025:Zdbf2 UTSW 1 63303650 missense possibly damaging 0.82
R5095:Zdbf2 UTSW 1 63309073 missense possibly damaging 0.66
R5149:Zdbf2 UTSW 1 63304903 missense possibly damaging 0.83
R5326:Zdbf2 UTSW 1 63304411 missense possibly damaging 0.66
R5341:Zdbf2 UTSW 1 63307933 missense probably benign 0.27
R5511:Zdbf2 UTSW 1 63305677 missense probably benign 0.03
R5809:Zdbf2 UTSW 1 63305876 missense possibly damaging 0.90
R5902:Zdbf2 UTSW 1 63306526 missense possibly damaging 0.83
R6162:Zdbf2 UTSW 1 63280818 start gained probably benign
R6245:Zdbf2 UTSW 1 63304433 missense possibly damaging 0.46
R6332:Zdbf2 UTSW 1 63307822 missense possibly damaging 0.66
R6361:Zdbf2 UTSW 1 63303321 missense possibly damaging 0.66
R6489:Zdbf2 UTSW 1 63307478 missense possibly damaging 0.46
R6517:Zdbf2 UTSW 1 63305520 missense possibly damaging 0.81
R6624:Zdbf2 UTSW 1 63303914 missense possibly damaging 0.46
R6643:Zdbf2 UTSW 1 63304508 missense possibly damaging 0.82
R6786:Zdbf2 UTSW 1 63304520 missense possibly damaging 0.46
R6808:Zdbf2 UTSW 1 63308528 missense possibly damaging 0.66
R6896:Zdbf2 UTSW 1 63308872 missense probably damaging 0.98
R6997:Zdbf2 UTSW 1 63290766 missense probably benign 0.09
R7011:Zdbf2 UTSW 1 63306766 missense possibly damaging 0.66
R7058:Zdbf2 UTSW 1 63307404 missense possibly damaging 0.66
R7066:Zdbf2 UTSW 1 63307559 missense probably benign
R7177:Zdbf2 UTSW 1 63294961 missense possibly damaging 0.94
R7184:Zdbf2 UTSW 1 63306505 missense possibly damaging 0.92
R7273:Zdbf2 UTSW 1 63303404 missense possibly damaging 0.90
R7387:Zdbf2 UTSW 1 63304039 missense possibly damaging 0.46
R7468:Zdbf2 UTSW 1 63307510 missense probably benign
R7695:Zdbf2 UTSW 1 63307370 missense possibly damaging 0.83
R7712:Zdbf2 UTSW 1 63305371 missense possibly damaging 0.83
R7735:Zdbf2 UTSW 1 63304105 missense possibly damaging 0.66
R7736:Zdbf2 UTSW 1 63308007 nonsense probably null
R7759:Zdbf2 UTSW 1 63308376 missense possibly damaging 0.46
R7796:Zdbf2 UTSW 1 63303424 missense possibly damaging 0.90
R7908:Zdbf2 UTSW 1 63306827 missense possibly damaging 0.46
R7970:Zdbf2 UTSW 1 63304171 missense possibly damaging 0.92
R8076:Zdbf2 UTSW 1 63306101 missense possibly damaging 0.92
R8152:Zdbf2 UTSW 1 63306413 missense possibly damaging 0.92
R8195:Zdbf2 UTSW 1 63304066 missense possibly damaging 0.83
R8272:Zdbf2 UTSW 1 63305983 missense probably benign
R8309:Zdbf2 UTSW 1 63306591 missense possibly damaging 0.82
R8323:Zdbf2 UTSW 1 63302914 missense possibly damaging 0.46
R8400:Zdbf2 UTSW 1 63304976 missense possibly damaging 0.92
R8443:Zdbf2 UTSW 1 63306007 missense possibly damaging 0.83
R8460:Zdbf2 UTSW 1 63309570 small deletion probably benign
R8528:Zdbf2 UTSW 1 63303386 missense possibly damaging 0.82
R8812:Zdbf2 UTSW 1 63308113 missense probably benign 0.00
R8962:Zdbf2 UTSW 1 63308003 missense probably benign 0.00
R9061:Zdbf2 UTSW 1 63307137 missense
R9072:Zdbf2 UTSW 1 63305764 missense possibly damaging 0.83
R9232:Zdbf2 UTSW 1 63308009 missense possibly damaging 0.66
R9257:Zdbf2 UTSW 1 63306241 missense probably damaging 1.00
R9411:Zdbf2 UTSW 1 63304129 missense probably damaging 0.97
R9470:Zdbf2 UTSW 1 63305625 missense possibly damaging 0.82
R9606:Zdbf2 UTSW 1 63303377 missense possibly damaging 0.92
R9621:Zdbf2 UTSW 1 63303476 missense possibly damaging 0.66
RF021:Zdbf2 UTSW 1 63302652 missense possibly damaging 0.82
X0018:Zdbf2 UTSW 1 63305351 missense possibly damaging 0.92
X0027:Zdbf2 UTSW 1 63308007 nonsense probably null
X0057:Zdbf2 UTSW 1 63305390 missense possibly damaging 0.66
X0063:Zdbf2 UTSW 1 63305537 missense probably benign 0.04
Z1176:Zdbf2 UTSW 1 63304245 missense possibly damaging 0.83
Z1177:Zdbf2 UTSW 1 63304086 frame shift probably null
Z1177:Zdbf2 UTSW 1 63309203 missense unknown
Predicted Primers PCR Primer
(F):5'- CACTGTTTCTGGAGCAACTTC -3'
(R):5'- GCTTCCTTCTTGAACAGGCAC -3'

Sequencing Primer
(F):5'- AGCAGTTCTCGTCAGGTGATTACAC -3'
(R):5'- AGGCACCTGGGGATGGTC -3'
Posted On 2020-07-28