Incidental Mutation 'R8306:Olfr1205'
ID641044
Institutional Source Beutler Lab
Gene Symbol Olfr1205
Ensembl Gene ENSMUSG00000057447
Gene Nameolfactory receptor 1205
SynonymsMOR230-1, MOR230-3, Olfr1203, GA_x6K02T2Q125-50304328-50305251, GA_x6K02T2Q125-50336588-50337313
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R8306 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location88829737-88837104 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88831289 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 57 (M57I)
Ref Sequence ENSEMBL: ENSMUSP00000075769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076438] [ENSMUST00000215929]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076438
AA Change: M57I

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000075769
Gene: ENSMUSG00000057447
AA Change: M57I

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 5e-45 PFAM
Pfam:7tm_1 39 285 9.1e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215929
AA Change: M57I

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 C A 11: 101,411,368 V158F probably damaging Het
Adam1b T C 5: 121,503,149 probably benign Het
Ambn G A 5: 88,459,422 E50K possibly damaging Het
Ash1l A G 3: 88,965,952 D14G probably benign Het
Asphd1 C T 7: 126,948,612 R173H probably damaging Het
Atr A T 9: 95,920,370 T1772S Het
Best3 T C 10: 117,002,610 L191P probably damaging Het
Bola1 A T 3: 96,197,201 S26T probably benign Het
Borcs6 T C 11: 69,059,820 L8P probably benign Het
Brca1 T G 11: 101,525,637 Q557P probably damaging Het
Brca2 G A 5: 150,536,663 E468K possibly damaging Het
Btbd11 T A 10: 85,598,545 C22* probably null Het
Capza2 T A 6: 17,637,132 L4Q probably benign Het
Cc2d2b T A 19: 40,815,784 Y918* probably null Het
Ccdc163 T C 4: 116,710,275 L67P probably damaging Het
Ccdc172 C A 19: 58,536,590 Q160K probably damaging Het
Ccp110 T A 7: 118,722,680 D519E probably benign Het
Cd300ld2 T C 11: 115,013,822 Q73R probably benign Het
Cfap46 T A 7: 139,656,580 D608V Het
Cfap69 T G 5: 5,604,287 Y549S probably benign Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Clu A C 14: 65,979,762 Q348P probably damaging Het
Cnot1 A T 8: 95,747,021 N1153K probably benign Het
Col2a1 T C 15: 97,990,968 probably null Het
Col6a6 A T 9: 105,784,073 I279N probably damaging Het
Dopey1 A G 9: 86,520,206 D1153G possibly damaging Het
Dpyd A G 3: 119,412,173 K888E probably benign Het
Eif2ak4 T C 2: 118,457,175 I1208T possibly damaging Het
Epha1 T C 6: 42,358,788 I972V probably damaging Het
Fam13c C T 10: 70,553,153 T503I probably benign Het
Fbxo43 T A 15: 36,161,867 Q398L probably benign Het
Fbxo44 A G 4: 148,158,632 I57T probably benign Het
Flnc T C 6: 29,449,370 I1422T probably benign Het
Flrt2 T C 12: 95,779,302 L138P probably damaging Het
Frem3 A G 8: 80,612,211 K378E possibly damaging Het
Ganc T A 2: 120,422,079 D128E probably benign Het
Gm19965 T C 1: 116,821,785 S399P Het
H2-Q1 A T 17: 35,321,021 K89* probably null Het
H2-Q2 A T 17: 35,342,325 probably benign Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Homer2 T A 7: 81,624,266 S125C possibly damaging Het
Hormad2 T C 11: 4,408,714 K231R probably benign Het
Kif17 A C 4: 138,277,909 K262Q probably damaging Het
Kif20a G A 18: 34,628,391 S279N probably benign Het
Lrp12 T C 15: 39,878,054 N441D probably damaging Het
Lta4h G T 10: 93,482,264 L515F possibly damaging Het
Mavs T C 2: 131,246,550 S425P probably benign Het
Mcat A C 15: 83,555,391 D99E probably damaging Het
Nav2 C A 7: 49,546,017 T1047K probably benign Het
Neb T A 2: 52,209,645 Y4731F probably damaging Het
Nectin4 G C 1: 171,383,757 R283P probably null Het
Notch3 G A 17: 32,158,112 T273I probably damaging Het
Olfr1415 T G 1: 92,491,525 I77L possibly damaging Het
Olfr152 A T 2: 87,783,486 *317C probably null Het
Olfr5 T A 7: 6,480,869 I96F possibly damaging Het
Pcdha12 A T 18: 37,022,585 T786S probably benign Het
Pde9a A G 17: 31,473,212 K520E probably benign Het
Piezo2 A C 18: 63,075,730 L1404R probably damaging Het
Rrbp1 T C 2: 143,950,496 S1321G probably benign Het
Rtkn T C 6: 83,151,916 V464A probably damaging Het
Rtn4rl1 T C 11: 75,265,321 F193S probably damaging Het
Samd4 G A 14: 46,884,917 V33I probably damaging Het
Scn5a A G 9: 119,521,291 L839P probably damaging Het
Slc6a17 C A 3: 107,473,669 V507L probably benign Het
Stradb C A 1: 58,991,197 N203K unknown Het
Tenm2 T C 11: 36,069,369 T1044A possibly damaging Het
Tmem245 A C 4: 56,886,037 W860G probably damaging Het
Tpst2 G A 5: 112,307,937 R114H probably damaging Het
Trappc10 C T 10: 78,200,626 D920N possibly damaging Het
Vmn1r59 T A 7: 5,453,967 I265L probably benign Het
Zbtb20 A C 16: 43,618,737 D667A probably damaging Het
Zbtb4 T A 11: 69,777,483 I344N probably damaging Het
Zdbf2 T A 1: 63,304,075 C538S possibly damaging Het
Zmym6 A T 4: 127,122,562 H712L probably damaging Het
Other mutations in Olfr1205
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Olfr1205 APN 2 88831112 splice site probably null
IGL02079:Olfr1205 APN 2 88831647 missense probably damaging 1.00
IGL02183:Olfr1205 APN 2 88832028 missense probably benign
IGL02813:Olfr1205 APN 2 88831151 missense probably benign 0.34
IGL02839:Olfr1205 APN 2 88831648 missense probably damaging 1.00
IGL02895:Olfr1205 APN 2 88831642 missense probably damaging 1.00
R0680:Olfr1205 UTSW 2 88831780 missense probably benign
R2029:Olfr1205 UTSW 2 88831405 missense possibly damaging 0.88
R2095:Olfr1205 UTSW 2 88831290 missense probably damaging 1.00
R6158:Olfr1205 UTSW 2 88831146 missense probably damaging 1.00
R6216:Olfr1205 UTSW 2 88831311 missense probably damaging 1.00
R6240:Olfr1205 UTSW 2 88831363 missense probably benign 0.22
R6377:Olfr1205 UTSW 2 88831269 nonsense probably null
R6429:Olfr1205 UTSW 2 88831525 missense probably benign 0.01
R6521:Olfr1205 UTSW 2 88831356 missense probably benign 0.03
R7065:Olfr1205 UTSW 2 88831386 missense probably damaging 1.00
R7343:Olfr1205 UTSW 2 88831846 missense probably damaging 1.00
R7476:Olfr1205 UTSW 2 88831588 missense probably benign 0.07
R7570:Olfr1205 UTSW 2 88831128 missense possibly damaging 0.82
R8303:Olfr1205 UTSW 2 88831289 missense possibly damaging 0.90
R8307:Olfr1205 UTSW 2 88831289 missense possibly damaging 0.90
R8308:Olfr1205 UTSW 2 88831289 missense possibly damaging 0.90
R8344:Olfr1205 UTSW 2 88831383 missense probably benign 0.00
R8386:Olfr1205 UTSW 2 88831289 missense possibly damaging 0.90
R8387:Olfr1205 UTSW 2 88831289 missense possibly damaging 0.90
Z1176:Olfr1205 UTSW 2 88831578 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGGACTGACACAATGCAGC -3'
(R):5'- ATGCAAGGGTTTACAGATGGC -3'

Sequencing Primer
(F):5'- TGCAGCAGAACAGCACTGTC -3'
(R):5'- GTTTACAGATGGCCACATAACGGTC -3'
Posted On2020-07-28