Incidental Mutation 'R8306:Ganc'
ID641046
Institutional Source Beutler Lab
Gene Symbol Ganc
Ensembl Gene ENSMUSG00000062646
Gene Nameglucosidase, alpha; neutral C
Synonyms5830445O15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.627) question?
Stock #R8306 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location120403896-120461700 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120422079 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 128 (D128E)
Ref Sequence ENSEMBL: ENSMUSP00000116898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000135074]
Predicted Effect probably benign
Transcript: ENSMUST00000135074
AA Change: D128E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000116898
Gene: ENSMUSG00000062646
AA Change: D128E

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
Pfam:Gal_mutarotas_2 221 292 2.3e-21 PFAM
Pfam:Glyco_hydro_31 333 778 2.5e-137 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycosyl hydrolase enzymes hydrolyse the glycosidic bond between two or more carbohydrates, or between a carbohydrate and a non-carbohydrate moiety. This gene encodes a member of glycosyl hydrolases family 31. This enzyme hydrolyses terminal, non-reducing 1,4-linked alpha-D-glucose residues and releases alpha-D-glucose. This is a key enzyme in glycogen metabolism and its gene localizes to a chromosomal region (15q15) that is associated with susceptibility to diabetes. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 C A 11: 101,411,368 V158F probably damaging Het
Adam1b T C 5: 121,503,149 probably benign Het
Ambn G A 5: 88,459,422 E50K possibly damaging Het
Ash1l A G 3: 88,965,952 D14G probably benign Het
Asphd1 C T 7: 126,948,612 R173H probably damaging Het
Atr A T 9: 95,920,370 T1772S Het
Best3 T C 10: 117,002,610 L191P probably damaging Het
Bola1 A T 3: 96,197,201 S26T probably benign Het
Borcs6 T C 11: 69,059,820 L8P probably benign Het
Brca1 T G 11: 101,525,637 Q557P probably damaging Het
Brca2 G A 5: 150,536,663 E468K possibly damaging Het
Btbd11 T A 10: 85,598,545 C22* probably null Het
Capza2 T A 6: 17,637,132 L4Q probably benign Het
Cc2d2b T A 19: 40,815,784 Y918* probably null Het
Ccdc163 T C 4: 116,710,275 L67P probably damaging Het
Ccdc172 C A 19: 58,536,590 Q160K probably damaging Het
Ccp110 T A 7: 118,722,680 D519E probably benign Het
Cd300ld2 T C 11: 115,013,822 Q73R probably benign Het
Cfap46 T A 7: 139,656,580 D608V Het
Cfap69 T G 5: 5,604,287 Y549S probably benign Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Clu A C 14: 65,979,762 Q348P probably damaging Het
Cnot1 A T 8: 95,747,021 N1153K probably benign Het
Col2a1 T C 15: 97,990,968 probably null Het
Col6a6 A T 9: 105,784,073 I279N probably damaging Het
Dopey1 A G 9: 86,520,206 D1153G possibly damaging Het
Dpyd A G 3: 119,412,173 K888E probably benign Het
Eif2ak4 T C 2: 118,457,175 I1208T possibly damaging Het
Epha1 T C 6: 42,358,788 I972V probably damaging Het
Fam13c C T 10: 70,553,153 T503I probably benign Het
Fbxo43 T A 15: 36,161,867 Q398L probably benign Het
Fbxo44 A G 4: 148,158,632 I57T probably benign Het
Flnc T C 6: 29,449,370 I1422T probably benign Het
Flrt2 T C 12: 95,779,302 L138P probably damaging Het
Frem3 A G 8: 80,612,211 K378E possibly damaging Het
Gm19965 T C 1: 116,821,785 S399P Het
H2-Q1 A T 17: 35,321,021 K89* probably null Het
H2-Q2 A T 17: 35,342,325 probably benign Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Homer2 T A 7: 81,624,266 S125C possibly damaging Het
Hormad2 T C 11: 4,408,714 K231R probably benign Het
Kif17 A C 4: 138,277,909 K262Q probably damaging Het
Kif20a G A 18: 34,628,391 S279N probably benign Het
Lrp12 T C 15: 39,878,054 N441D probably damaging Het
Lta4h G T 10: 93,482,264 L515F possibly damaging Het
Mavs T C 2: 131,246,550 S425P probably benign Het
Mcat A C 15: 83,555,391 D99E probably damaging Het
Nav2 C A 7: 49,546,017 T1047K probably benign Het
Neb T A 2: 52,209,645 Y4731F probably damaging Het
Nectin4 G C 1: 171,383,757 R283P probably null Het
Notch3 G A 17: 32,158,112 T273I probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr1415 T G 1: 92,491,525 I77L possibly damaging Het
Olfr152 A T 2: 87,783,486 *317C probably null Het
Olfr5 T A 7: 6,480,869 I96F possibly damaging Het
Pcdha12 A T 18: 37,022,585 T786S probably benign Het
Pde9a A G 17: 31,473,212 K520E probably benign Het
Piezo2 A C 18: 63,075,730 L1404R probably damaging Het
Rrbp1 T C 2: 143,950,496 S1321G probably benign Het
Rtkn T C 6: 83,151,916 V464A probably damaging Het
Rtn4rl1 T C 11: 75,265,321 F193S probably damaging Het
Samd4 G A 14: 46,884,917 V33I probably damaging Het
Scn5a A G 9: 119,521,291 L839P probably damaging Het
Slc6a17 C A 3: 107,473,669 V507L probably benign Het
Stradb C A 1: 58,991,197 N203K unknown Het
Tenm2 T C 11: 36,069,369 T1044A possibly damaging Het
Tmem245 A C 4: 56,886,037 W860G probably damaging Het
Tpst2 G A 5: 112,307,937 R114H probably damaging Het
Trappc10 C T 10: 78,200,626 D920N possibly damaging Het
Vmn1r59 T A 7: 5,453,967 I265L probably benign Het
Zbtb20 A C 16: 43,618,737 D667A probably damaging Het
Zbtb4 T A 11: 69,777,483 I344N probably damaging Het
Zdbf2 T A 1: 63,304,075 C538S possibly damaging Het
Zmym6 A T 4: 127,122,562 H712L probably damaging Het
Other mutations in Ganc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Ganc APN 2 120441598 missense probably damaging 1.00
IGL00913:Ganc APN 2 120439452 splice site probably benign
IGL01077:Ganc APN 2 120446515 missense possibly damaging 0.50
IGL01773:Ganc APN 2 120459884 missense possibly damaging 0.87
IGL01812:Ganc APN 2 120411526 missense probably benign 0.00
IGL02029:Ganc APN 2 120459857 missense probably benign 0.00
IGL02067:Ganc APN 2 120406304 missense probably benign 0.16
IGL02290:Ganc APN 2 120448423 missense possibly damaging 0.90
IGL02355:Ganc APN 2 120433757 missense probably damaging 1.00
IGL02362:Ganc APN 2 120433757 missense probably damaging 1.00
IGL02553:Ganc APN 2 120458134 missense probably benign
IGL02808:Ganc APN 2 120411511 missense probably benign 0.00
IGL02966:Ganc APN 2 120433648 missense probably damaging 1.00
IGL03356:Ganc APN 2 120435288 missense probably benign 0.22
IGL03405:Ganc APN 2 120433766 missense probably damaging 1.00
ingenuous UTSW 2 120444149 missense probably damaging 1.00
R0464:Ganc UTSW 2 120436694 missense probably benign 0.07
R0511:Ganc UTSW 2 120448401 nonsense probably null
R0932:Ganc UTSW 2 120458129 missense probably damaging 0.99
R1467:Ganc UTSW 2 120430928 splice site probably benign
R1902:Ganc UTSW 2 120446482 missense probably damaging 1.00
R2087:Ganc UTSW 2 120457257 missense probably damaging 1.00
R4668:Ganc UTSW 2 120431067 missense probably benign 0.02
R4669:Ganc UTSW 2 120431067 missense probably benign 0.02
R4725:Ganc UTSW 2 120435273 missense probably damaging 0.99
R4735:Ganc UTSW 2 120436623 splice site silent
R4738:Ganc UTSW 2 120452594 missense probably damaging 0.97
R4839:Ganc UTSW 2 120459823 missense probably benign
R4951:Ganc UTSW 2 120456047 missense probably benign 0.00
R5841:Ganc UTSW 2 120411539 missense possibly damaging 0.65
R5997:Ganc UTSW 2 120430605 missense possibly damaging 0.55
R6142:Ganc UTSW 2 120430737 critical splice donor site probably null
R6378:Ganc UTSW 2 120433826 missense probably damaging 1.00
R6711:Ganc UTSW 2 120450839 missense possibly damaging 0.74
R6777:Ganc UTSW 2 120444149 missense probably damaging 1.00
R7229:Ganc UTSW 2 120427775 missense possibly damaging 0.92
R7235:Ganc UTSW 2 120433717 missense probably damaging 1.00
R7241:Ganc UTSW 2 120441529 missense probably damaging 1.00
R7326:Ganc UTSW 2 120430599 missense probably damaging 1.00
R7567:Ganc UTSW 2 120456101 missense probably benign 0.01
R7685:Ganc UTSW 2 120433792 missense probably damaging 1.00
R7736:Ganc UTSW 2 120433814 missense possibly damaging 0.83
R7784:Ganc UTSW 2 120436668 nonsense probably null
R7955:Ganc UTSW 2 120430700 missense probably damaging 1.00
R8222:Ganc UTSW 2 120446452 missense probably damaging 1.00
R8247:Ganc UTSW 2 120436700 missense probably null 0.52
X0027:Ganc UTSW 2 120448450 missense probably damaging 1.00
Z1177:Ganc UTSW 2 120433794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGAAGTTCCGTGTAAGCTCTCTC -3'
(R):5'- TTCCAGACAGGCTCCGTTAAG -3'

Sequencing Primer
(F):5'- GATGGCTCCTTACTGTAGGTCTAAC -3'
(R):5'- CAGGCTCCGTTAAGGTAGATC -3'
Posted On2020-07-28