Incidental Mutation 'R8306:Zmym6'
ID641055
Institutional Source Beutler Lab
Gene Symbol Zmym6
Ensembl Gene ENSMUSG00000042408
Gene Namezinc finger, MYM-type 6
SynonymsZfp258, D4Wsu24e, 9330177P20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8306 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location127077383-127124372 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127122562 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 712 (H712L)
Ref Sequence ENSEMBL: ENSMUSP00000045366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046751] [ENSMUST00000094712] [ENSMUST00000094713] [ENSMUST00000106097]
Predicted Effect probably damaging
Transcript: ENSMUST00000046751
AA Change: H712L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045366
Gene: ENSMUSG00000042408
AA Change: H712L

DomainStartEndE-ValueType
Blast:TRASH 77 113 1e-12 BLAST
TRASH 123 163 1.18e-1 SMART
TRASH 197 231 5.47e3 SMART
TRASH 241 277 4.01e1 SMART
TRASH 349 385 2.46e1 SMART
TRASH 391 426 3.32e2 SMART
TRASH 434 472 2.91e-1 SMART
TRASH 478 513 9.99e0 SMART
low complexity region 602 612 N/A INTRINSIC
low complexity region 642 656 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094712
SMART Domains Protein: ENSMUSP00000092302
Gene: ENSMUSG00000070737

DomainStartEndE-ValueType
Pfam:DoxX 5 103 9e-9 PFAM
Pfam:DoxX_2 7 124 4.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094713
AA Change: H620L

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000092303
Gene: ENSMUSG00000042408
AA Change: H620L

DomainStartEndE-ValueType
Blast:TRASH 77 113 1e-12 BLAST
TRASH 123 163 1.18e-1 SMART
TRASH 197 231 5.47e3 SMART
TRASH 262 293 6.03e2 SMART
TRASH 299 334 3.32e2 SMART
TRASH 342 380 2.91e-1 SMART
TRASH 386 421 9.99e0 SMART
low complexity region 510 520 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106097
SMART Domains Protein: ENSMUSP00000101703
Gene: ENSMUSG00000070737

DomainStartEndE-ValueType
Pfam:DoxX_2 27 111 8.1e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 C A 11: 101,411,368 V158F probably damaging Het
Adam1b T C 5: 121,503,149 probably benign Het
Ambn G A 5: 88,459,422 E50K possibly damaging Het
Ash1l A G 3: 88,965,952 D14G probably benign Het
Asphd1 C T 7: 126,948,612 R173H probably damaging Het
Atr A T 9: 95,920,370 T1772S Het
Best3 T C 10: 117,002,610 L191P probably damaging Het
Bola1 A T 3: 96,197,201 S26T probably benign Het
Borcs6 T C 11: 69,059,820 L8P probably benign Het
Brca1 T G 11: 101,525,637 Q557P probably damaging Het
Brca2 G A 5: 150,536,663 E468K possibly damaging Het
Btbd11 T A 10: 85,598,545 C22* probably null Het
Capza2 T A 6: 17,637,132 L4Q probably benign Het
Cc2d2b T A 19: 40,815,784 Y918* probably null Het
Ccdc163 T C 4: 116,710,275 L67P probably damaging Het
Ccdc172 C A 19: 58,536,590 Q160K probably damaging Het
Ccp110 T A 7: 118,722,680 D519E probably benign Het
Cd300ld2 T C 11: 115,013,822 Q73R probably benign Het
Cfap46 T A 7: 139,656,580 D608V Het
Cfap69 T G 5: 5,604,287 Y549S probably benign Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Clu A C 14: 65,979,762 Q348P probably damaging Het
Cnot1 A T 8: 95,747,021 N1153K probably benign Het
Col2a1 T C 15: 97,990,968 probably null Het
Col6a6 A T 9: 105,784,073 I279N probably damaging Het
Dopey1 A G 9: 86,520,206 D1153G possibly damaging Het
Dpyd A G 3: 119,412,173 K888E probably benign Het
Eif2ak4 T C 2: 118,457,175 I1208T possibly damaging Het
Epha1 T C 6: 42,358,788 I972V probably damaging Het
Fam13c C T 10: 70,553,153 T503I probably benign Het
Fbxo43 T A 15: 36,161,867 Q398L probably benign Het
Fbxo44 A G 4: 148,158,632 I57T probably benign Het
Flnc T C 6: 29,449,370 I1422T probably benign Het
Flrt2 T C 12: 95,779,302 L138P probably damaging Het
Frem3 A G 8: 80,612,211 K378E possibly damaging Het
Ganc T A 2: 120,422,079 D128E probably benign Het
Gm19965 T C 1: 116,821,785 S399P Het
H2-Q1 A T 17: 35,321,021 K89* probably null Het
H2-Q2 A T 17: 35,342,325 probably benign Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Homer2 T A 7: 81,624,266 S125C possibly damaging Het
Hormad2 T C 11: 4,408,714 K231R probably benign Het
Kif17 A C 4: 138,277,909 K262Q probably damaging Het
Kif20a G A 18: 34,628,391 S279N probably benign Het
Lrp12 T C 15: 39,878,054 N441D probably damaging Het
Lta4h G T 10: 93,482,264 L515F possibly damaging Het
Mavs T C 2: 131,246,550 S425P probably benign Het
Mcat A C 15: 83,555,391 D99E probably damaging Het
Nav2 C A 7: 49,546,017 T1047K probably benign Het
Neb T A 2: 52,209,645 Y4731F probably damaging Het
Nectin4 G C 1: 171,383,757 R283P probably null Het
Notch3 G A 17: 32,158,112 T273I probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr1415 T G 1: 92,491,525 I77L possibly damaging Het
Olfr152 A T 2: 87,783,486 *317C probably null Het
Olfr5 T A 7: 6,480,869 I96F possibly damaging Het
Pcdha12 A T 18: 37,022,585 T786S probably benign Het
Pde9a A G 17: 31,473,212 K520E probably benign Het
Piezo2 A C 18: 63,075,730 L1404R probably damaging Het
Rrbp1 T C 2: 143,950,496 S1321G probably benign Het
Rtkn T C 6: 83,151,916 V464A probably damaging Het
Rtn4rl1 T C 11: 75,265,321 F193S probably damaging Het
Samd4 G A 14: 46,884,917 V33I probably damaging Het
Scn5a A G 9: 119,521,291 L839P probably damaging Het
Slc6a17 C A 3: 107,473,669 V507L probably benign Het
Stradb C A 1: 58,991,197 N203K unknown Het
Tenm2 T C 11: 36,069,369 T1044A possibly damaging Het
Tmem245 A C 4: 56,886,037 W860G probably damaging Het
Tpst2 G A 5: 112,307,937 R114H probably damaging Het
Trappc10 C T 10: 78,200,626 D920N possibly damaging Het
Vmn1r59 T A 7: 5,453,967 I265L probably benign Het
Zbtb20 A C 16: 43,618,737 D667A probably damaging Het
Zbtb4 T A 11: 69,777,483 I344N probably damaging Het
Zdbf2 T A 1: 63,304,075 C538S possibly damaging Het
Other mutations in Zmym6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Zmym6 APN 4 127101949 nonsense probably null
IGL00486:Zmym6 APN 4 127124185 utr 5 prime probably benign
IGL01017:Zmym6 APN 4 127088359 missense probably benign 0.00
IGL01385:Zmym6 APN 4 127124106 missense probably benign 0.02
IGL01577:Zmym6 APN 4 127105430 missense probably damaging 1.00
IGL01654:Zmym6 APN 4 127123726 missense probably damaging 1.00
IGL01736:Zmym6 APN 4 127108644 missense probably damaging 1.00
IGL01824:Zmym6 APN 4 127108706 missense probably damaging 0.99
IGL01916:Zmym6 APN 4 127123756 missense probably damaging 0.98
IGL01985:Zmym6 APN 4 127100748 missense probably damaging 1.00
IGL02056:Zmym6 APN 4 127103414 missense probably damaging 1.00
IGL02477:Zmym6 APN 4 127078502 nonsense probably null
IGL02754:Zmym6 APN 4 127109971 splice site probably benign
IGL03344:Zmym6 APN 4 127120521 missense probably damaging 1.00
IGL03412:Zmym6 APN 4 127092938 missense probably damaging 1.00
R0335:Zmym6 UTSW 4 127122808 missense probably damaging 1.00
R0448:Zmym6 UTSW 4 127108694 missense probably benign 0.01
R0463:Zmym6 UTSW 4 127122772 missense probably damaging 0.98
R0538:Zmym6 UTSW 4 127123369 missense probably benign 0.21
R0789:Zmym6 UTSW 4 127122822 missense possibly damaging 0.52
R0798:Zmym6 UTSW 4 127103523 missense probably benign 0.00
R1311:Zmym6 UTSW 4 127123358 missense probably damaging 1.00
R1351:Zmym6 UTSW 4 127123005 missense probably benign 0.00
R1429:Zmym6 UTSW 4 127123879 missense probably damaging 1.00
R1636:Zmym6 UTSW 4 127123767 missense probably damaging 0.99
R1666:Zmym6 UTSW 4 127122859 missense probably damaging 0.98
R1919:Zmym6 UTSW 4 127103414 missense probably damaging 1.00
R2058:Zmym6 UTSW 4 127088415 nonsense probably null
R3957:Zmym6 UTSW 4 127123296 missense possibly damaging 0.68
R3978:Zmym6 UTSW 4 127123555 missense possibly damaging 0.71
R4417:Zmym6 UTSW 4 127092988 missense probably damaging 1.00
R4801:Zmym6 UTSW 4 127123216 missense probably benign 0.19
R4802:Zmym6 UTSW 4 127123216 missense probably benign 0.19
R5052:Zmym6 UTSW 4 127123974 missense possibly damaging 0.92
R5105:Zmym6 UTSW 4 127123758 missense probably benign 0.33
R5217:Zmym6 UTSW 4 127105374 missense possibly damaging 0.76
R5682:Zmym6 UTSW 4 127104407 missense probably damaging 1.00
R5841:Zmym6 UTSW 4 127100670 missense possibly damaging 0.71
R5991:Zmym6 UTSW 4 127108473 splice site probably null
R6478:Zmym6 UTSW 4 127123383 missense possibly damaging 0.86
R7014:Zmym6 UTSW 4 127123544 nonsense probably null
R7287:Zmym6 UTSW 4 127122982 missense possibly damaging 0.50
R7290:Zmym6 UTSW 4 127123501 missense possibly damaging 0.73
R7371:Zmym6 UTSW 4 127104313 missense probably damaging 1.00
R7967:Zmym6 UTSW 4 127122660 missense probably benign 0.03
R8237:Zmym6 UTSW 4 127122751 missense probably damaging 0.99
R8312:Zmym6 UTSW 4 127123834 missense probably damaging 1.00
X0025:Zmym6 UTSW 4 127122350 missense possibly damaging 0.60
X0067:Zmym6 UTSW 4 127104314 missense probably damaging 1.00
Z1177:Zmym6 UTSW 4 127123797 missense not run
Predicted Primers PCR Primer
(F):5'- CCTTTAGATTTACCTCTGCCAGAATG -3'
(R):5'- AATCGAGAATGGCTTATTCCTGGC -3'

Sequencing Primer
(F):5'- GAGTGAAGAACCTGAGTCTCCAC -3'
(R):5'- ATTCCTGGCGGCAATTTGGAAAG -3'
Posted On2020-07-28