Incidental Mutation 'R8306:Zmym6'
ID 641055
Institutional Source Beutler Lab
Gene Symbol Zmym6
Ensembl Gene ENSMUSG00000042408
Gene Name zinc finger, MYM-type 6
Synonyms 9330177P20Rik, Zfp258, D4Wsu24e
MMRRC Submission 067792-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8306 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 126971176-127018165 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 127016355 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 712 (H712L)
Ref Sequence ENSEMBL: ENSMUSP00000045366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046751] [ENSMUST00000094712] [ENSMUST00000094713] [ENSMUST00000106097]
AlphaFold Q8BS54
Predicted Effect probably damaging
Transcript: ENSMUST00000046751
AA Change: H712L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045366
Gene: ENSMUSG00000042408
AA Change: H712L

DomainStartEndE-ValueType
Blast:TRASH 77 113 1e-12 BLAST
TRASH 123 163 1.18e-1 SMART
TRASH 197 231 5.47e3 SMART
TRASH 241 277 4.01e1 SMART
TRASH 349 385 2.46e1 SMART
TRASH 391 426 3.32e2 SMART
TRASH 434 472 2.91e-1 SMART
TRASH 478 513 9.99e0 SMART
low complexity region 602 612 N/A INTRINSIC
low complexity region 642 656 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094712
SMART Domains Protein: ENSMUSP00000092302
Gene: ENSMUSG00000070737

DomainStartEndE-ValueType
Pfam:DoxX 5 103 9e-9 PFAM
Pfam:DoxX_2 7 124 4.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094713
AA Change: H620L

PolyPhen 2 Score 0.230 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000092303
Gene: ENSMUSG00000042408
AA Change: H620L

DomainStartEndE-ValueType
Blast:TRASH 77 113 1e-12 BLAST
TRASH 123 163 1.18e-1 SMART
TRASH 197 231 5.47e3 SMART
TRASH 262 293 6.03e2 SMART
TRASH 299 334 3.32e2 SMART
TRASH 342 380 2.91e-1 SMART
TRASH 386 421 9.99e0 SMART
low complexity region 510 520 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106097
SMART Domains Protein: ENSMUSP00000101703
Gene: ENSMUSG00000070737

DomainStartEndE-ValueType
Pfam:DoxX_2 27 111 8.1e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 C A 11: 101,302,194 (GRCm39) V158F probably damaging Het
Abtb3 T A 10: 85,434,409 (GRCm39) C22* probably null Het
Adam1b T C 5: 121,641,212 (GRCm39) probably benign Het
Ambn G A 5: 88,607,281 (GRCm39) E50K possibly damaging Het
Ash1l A G 3: 88,873,259 (GRCm39) D14G probably benign Het
Asphd1 C T 7: 126,547,784 (GRCm39) R173H probably damaging Het
Atr A T 9: 95,802,423 (GRCm39) T1772S Het
Best3 T C 10: 116,838,515 (GRCm39) L191P probably damaging Het
Bola1 A T 3: 96,104,517 (GRCm39) S26T probably benign Het
Borcs6 T C 11: 68,950,646 (GRCm39) L8P probably benign Het
Brca1 T G 11: 101,416,463 (GRCm39) Q557P probably damaging Het
Brca2 G A 5: 150,460,128 (GRCm39) E468K possibly damaging Het
Capza2 T A 6: 17,637,131 (GRCm39) L4Q probably benign Het
Cc2d2b T A 19: 40,804,228 (GRCm39) Y918* probably null Het
Ccdc163 T C 4: 116,567,472 (GRCm39) L67P probably damaging Het
Ccdc172 C A 19: 58,525,022 (GRCm39) Q160K probably damaging Het
Ccp110 T A 7: 118,321,903 (GRCm39) D519E probably benign Het
Cd300ld2 T C 11: 114,904,648 (GRCm39) Q73R probably benign Het
Cfap46 T A 7: 139,236,496 (GRCm39) D608V Het
Cfap69 T G 5: 5,654,287 (GRCm39) Y549S probably benign Het
Cilp G A 9: 65,186,286 (GRCm39) G794S probably damaging Het
Clu A C 14: 66,217,211 (GRCm39) Q348P probably damaging Het
Cnot1 A T 8: 96,473,649 (GRCm39) N1153K probably benign Het
Col2a1 T C 15: 97,888,849 (GRCm39) probably null Het
Col6a6 A T 9: 105,661,272 (GRCm39) I279N probably damaging Het
Dop1a A G 9: 86,402,259 (GRCm39) D1153G possibly damaging Het
Dpyd A G 3: 119,205,822 (GRCm39) K888E probably benign Het
Eif2ak4 T C 2: 118,287,656 (GRCm39) I1208T possibly damaging Het
Epha1 T C 6: 42,335,722 (GRCm39) I972V probably damaging Het
Fam13c C T 10: 70,388,983 (GRCm39) T503I probably benign Het
Fbxo43 T A 15: 36,162,013 (GRCm39) Q398L probably benign Het
Fbxo44 A G 4: 148,243,089 (GRCm39) I57T probably benign Het
Flnc T C 6: 29,449,369 (GRCm39) I1422T probably benign Het
Flrt2 T C 12: 95,746,076 (GRCm39) L138P probably damaging Het
Frem3 A G 8: 81,338,840 (GRCm39) K378E possibly damaging Het
Ganc T A 2: 120,252,560 (GRCm39) D128E probably benign Het
Gm19965 T C 1: 116,749,515 (GRCm39) S399P Het
H2-Q1 A T 17: 35,539,997 (GRCm39) K89* probably null Het
H2-Q2 A T 17: 35,561,301 (GRCm39) probably benign Het
Hmmr G A 11: 40,612,499 (GRCm39) S206F probably damaging Het
Homer2 T A 7: 81,274,014 (GRCm39) S125C possibly damaging Het
Hormad2 T C 11: 4,358,714 (GRCm39) K231R probably benign Het
Kif17 A C 4: 138,005,220 (GRCm39) K262Q probably damaging Het
Kif20a G A 18: 34,761,444 (GRCm39) S279N probably benign Het
Lrp12 T C 15: 39,741,450 (GRCm39) N441D probably damaging Het
Lta4h G T 10: 93,318,126 (GRCm39) L515F possibly damaging Het
Mavs T C 2: 131,088,470 (GRCm39) S425P probably benign Het
Mcat A C 15: 83,439,592 (GRCm39) D99E probably damaging Het
Nav2 C A 7: 49,195,765 (GRCm39) T1047K probably benign Het
Neb T A 2: 52,099,657 (GRCm39) Y4731F probably damaging Het
Nectin4 G C 1: 171,211,325 (GRCm39) R283P probably null Het
Notch3 G A 17: 32,377,086 (GRCm39) T273I probably damaging Het
Or4c11c G A 2: 88,661,633 (GRCm39) M57I possibly damaging Het
Or5i1 A T 2: 87,613,830 (GRCm39) *317C probably null Het
Or6b2b T G 1: 92,419,247 (GRCm39) I77L possibly damaging Het
Or6z7 T A 7: 6,483,868 (GRCm39) I96F possibly damaging Het
Pcdha12 A T 18: 37,155,638 (GRCm39) T786S probably benign Het
Pde9a A G 17: 31,692,186 (GRCm39) K520E probably benign Het
Piezo2 A C 18: 63,208,801 (GRCm39) L1404R probably damaging Het
Rrbp1 T C 2: 143,792,416 (GRCm39) S1321G probably benign Het
Rtkn T C 6: 83,128,897 (GRCm39) V464A probably damaging Het
Rtn4rl1 T C 11: 75,156,147 (GRCm39) F193S probably damaging Het
Samd4 G A 14: 47,122,374 (GRCm39) V33I probably damaging Het
Scn5a A G 9: 119,350,357 (GRCm39) L839P probably damaging Het
Slc6a17 C A 3: 107,380,985 (GRCm39) V507L probably benign Het
Stradb C A 1: 59,030,356 (GRCm39) N203K unknown Het
Tenm2 T C 11: 35,960,196 (GRCm39) T1044A possibly damaging Het
Tmem245 A C 4: 56,886,037 (GRCm39) W860G probably damaging Het
Tpst2 G A 5: 112,455,803 (GRCm39) R114H probably damaging Het
Trappc10 C T 10: 78,036,460 (GRCm39) D920N possibly damaging Het
Vmn1r59 T A 7: 5,456,966 (GRCm39) I265L probably benign Het
Zbtb20 A C 16: 43,439,100 (GRCm39) D667A probably damaging Het
Zbtb4 T A 11: 69,668,309 (GRCm39) I344N probably damaging Het
Zdbf2 T A 1: 63,343,234 (GRCm39) C538S possibly damaging Het
Other mutations in Zmym6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Zmym6 APN 4 126,995,742 (GRCm39) nonsense probably null
IGL00486:Zmym6 APN 4 127,017,978 (GRCm39) utr 5 prime probably benign
IGL01017:Zmym6 APN 4 126,982,152 (GRCm39) missense probably benign 0.00
IGL01385:Zmym6 APN 4 127,017,899 (GRCm39) missense probably benign 0.02
IGL01577:Zmym6 APN 4 126,999,223 (GRCm39) missense probably damaging 1.00
IGL01654:Zmym6 APN 4 127,017,519 (GRCm39) missense probably damaging 1.00
IGL01736:Zmym6 APN 4 127,002,437 (GRCm39) missense probably damaging 1.00
IGL01824:Zmym6 APN 4 127,002,499 (GRCm39) missense probably damaging 0.99
IGL01916:Zmym6 APN 4 127,017,549 (GRCm39) missense probably damaging 0.98
IGL01985:Zmym6 APN 4 126,994,541 (GRCm39) missense probably damaging 1.00
IGL02056:Zmym6 APN 4 126,997,207 (GRCm39) missense probably damaging 1.00
IGL02477:Zmym6 APN 4 126,972,295 (GRCm39) nonsense probably null
IGL02754:Zmym6 APN 4 127,003,764 (GRCm39) splice site probably benign
IGL03344:Zmym6 APN 4 127,014,314 (GRCm39) missense probably damaging 1.00
IGL03412:Zmym6 APN 4 126,986,731 (GRCm39) missense probably damaging 1.00
R0335:Zmym6 UTSW 4 127,016,601 (GRCm39) missense probably damaging 1.00
R0448:Zmym6 UTSW 4 127,002,487 (GRCm39) missense probably benign 0.01
R0463:Zmym6 UTSW 4 127,016,565 (GRCm39) missense probably damaging 0.98
R0538:Zmym6 UTSW 4 127,017,162 (GRCm39) missense probably benign 0.21
R0789:Zmym6 UTSW 4 127,016,615 (GRCm39) missense possibly damaging 0.52
R0798:Zmym6 UTSW 4 126,997,316 (GRCm39) missense probably benign 0.00
R1311:Zmym6 UTSW 4 127,017,151 (GRCm39) missense probably damaging 1.00
R1351:Zmym6 UTSW 4 127,016,798 (GRCm39) missense probably benign 0.00
R1429:Zmym6 UTSW 4 127,017,672 (GRCm39) missense probably damaging 1.00
R1636:Zmym6 UTSW 4 127,017,560 (GRCm39) missense probably damaging 0.99
R1666:Zmym6 UTSW 4 127,016,652 (GRCm39) missense probably damaging 0.98
R1919:Zmym6 UTSW 4 126,997,207 (GRCm39) missense probably damaging 1.00
R2058:Zmym6 UTSW 4 126,982,208 (GRCm39) nonsense probably null
R3957:Zmym6 UTSW 4 127,017,089 (GRCm39) missense possibly damaging 0.68
R3978:Zmym6 UTSW 4 127,017,348 (GRCm39) missense possibly damaging 0.71
R4417:Zmym6 UTSW 4 126,986,781 (GRCm39) missense probably damaging 1.00
R4801:Zmym6 UTSW 4 127,017,009 (GRCm39) missense probably benign 0.19
R4802:Zmym6 UTSW 4 127,017,009 (GRCm39) missense probably benign 0.19
R5052:Zmym6 UTSW 4 127,017,767 (GRCm39) missense possibly damaging 0.92
R5105:Zmym6 UTSW 4 127,017,551 (GRCm39) missense probably benign 0.33
R5217:Zmym6 UTSW 4 126,999,167 (GRCm39) missense possibly damaging 0.76
R5682:Zmym6 UTSW 4 126,998,200 (GRCm39) missense probably damaging 1.00
R5841:Zmym6 UTSW 4 126,994,463 (GRCm39) missense possibly damaging 0.71
R5991:Zmym6 UTSW 4 127,002,266 (GRCm39) splice site probably null
R6478:Zmym6 UTSW 4 127,017,176 (GRCm39) missense possibly damaging 0.86
R7014:Zmym6 UTSW 4 127,017,337 (GRCm39) nonsense probably null
R7287:Zmym6 UTSW 4 127,016,775 (GRCm39) missense possibly damaging 0.50
R7290:Zmym6 UTSW 4 127,017,294 (GRCm39) missense possibly damaging 0.73
R7371:Zmym6 UTSW 4 126,998,106 (GRCm39) missense probably damaging 1.00
R7967:Zmym6 UTSW 4 127,016,453 (GRCm39) missense probably benign 0.03
R8237:Zmym6 UTSW 4 127,016,544 (GRCm39) missense probably damaging 0.99
R8312:Zmym6 UTSW 4 127,017,627 (GRCm39) missense probably damaging 1.00
R9090:Zmym6 UTSW 4 127,017,854 (GRCm39) missense probably damaging 0.99
R9216:Zmym6 UTSW 4 127,002,500 (GRCm39) missense probably benign 0.00
R9271:Zmym6 UTSW 4 127,017,854 (GRCm39) missense probably damaging 0.99
R9695:Zmym6 UTSW 4 127,016,340 (GRCm39) missense probably benign
X0025:Zmym6 UTSW 4 127,016,143 (GRCm39) missense possibly damaging 0.60
X0067:Zmym6 UTSW 4 126,998,107 (GRCm39) missense probably damaging 1.00
Z1177:Zmym6 UTSW 4 127,017,590 (GRCm39) missense not run
Predicted Primers PCR Primer
(F):5'- CCTTTAGATTTACCTCTGCCAGAATG -3'
(R):5'- AATCGAGAATGGCTTATTCCTGGC -3'

Sequencing Primer
(F):5'- GAGTGAAGAACCTGAGTCTCCAC -3'
(R):5'- ATTCCTGGCGGCAATTTGGAAAG -3'
Posted On 2020-07-28