Incidental Mutation 'R8306:Tpst2'
ID641060
Institutional Source Beutler Lab
Gene Symbol Tpst2
Ensembl Gene ENSMUSG00000029344
Gene Nameprotein-tyrosine sulfotransferase 2
SynonymsD5Ucla3, grm, Tango13b, grt
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.752) question?
Stock #R8306 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location112276691-112315361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 112307937 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 114 (R114H)
Ref Sequence ENSEMBL: ENSMUSP00000031287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031287] [ENSMUST00000071455] [ENSMUST00000151947]
Predicted Effect probably damaging
Transcript: ENSMUST00000031287
AA Change: R114H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031287
Gene: ENSMUSG00000029344
AA Change: R114H

DomainStartEndE-ValueType
low complexity region 22 43 N/A INTRINSIC
Pfam:Sulfotransfer_3 82 272 8.8e-19 PFAM
Pfam:Sulfotransfer_1 82 284 2.8e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000071455
AA Change: R114H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071399
Gene: ENSMUSG00000029344
AA Change: R114H

DomainStartEndE-ValueType
low complexity region 22 43 N/A INTRINSIC
Pfam:Sulfotransfer_3 82 276 8.4e-16 PFAM
Pfam:Sulfotransfer_1 82 284 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140262
SMART Domains Protein: ENSMUSP00000116816
Gene: ENSMUSG00000029344

DomainStartEndE-ValueType
PDB:3AP2|B 2 63 4e-36 PDB
SCOP:d1fmja_ 3 55 9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151947
Predicted Effect probably benign
Transcript: ENSMUST00000198502
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the O-sulfation of tyrosine residues within acidic regions of proteins. The encoded protein is a type II integral membrane protein found in the Golgi body. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Spontaneous mutants show a delayed rise and a prolonged deficit of pituitary growth hormone resulting in delayed pubertal growth, hypothyroidism, and an enlarged adenohypophysis with aberrant chromophobic cells. Homozygous null mice show a modest but transient pubertal growth lag and male sterility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 C A 11: 101,411,368 V158F probably damaging Het
Adam1b T C 5: 121,503,149 probably benign Het
Ambn G A 5: 88,459,422 E50K possibly damaging Het
Ash1l A G 3: 88,965,952 D14G probably benign Het
Asphd1 C T 7: 126,948,612 R173H probably damaging Het
Atr A T 9: 95,920,370 T1772S Het
Best3 T C 10: 117,002,610 L191P probably damaging Het
Bola1 A T 3: 96,197,201 S26T probably benign Het
Borcs6 T C 11: 69,059,820 L8P probably benign Het
Brca1 T G 11: 101,525,637 Q557P probably damaging Het
Brca2 G A 5: 150,536,663 E468K possibly damaging Het
Btbd11 T A 10: 85,598,545 C22* probably null Het
Capza2 T A 6: 17,637,132 L4Q probably benign Het
Cc2d2b T A 19: 40,815,784 Y918* probably null Het
Ccdc163 T C 4: 116,710,275 L67P probably damaging Het
Ccdc172 C A 19: 58,536,590 Q160K probably damaging Het
Ccp110 T A 7: 118,722,680 D519E probably benign Het
Cd300ld2 T C 11: 115,013,822 Q73R probably benign Het
Cfap46 T A 7: 139,656,580 D608V Het
Cfap69 T G 5: 5,604,287 Y549S probably benign Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Clu A C 14: 65,979,762 Q348P probably damaging Het
Cnot1 A T 8: 95,747,021 N1153K probably benign Het
Col2a1 T C 15: 97,990,968 probably null Het
Col6a6 A T 9: 105,784,073 I279N probably damaging Het
Dopey1 A G 9: 86,520,206 D1153G possibly damaging Het
Dpyd A G 3: 119,412,173 K888E probably benign Het
Eif2ak4 T C 2: 118,457,175 I1208T possibly damaging Het
Epha1 T C 6: 42,358,788 I972V probably damaging Het
Fam13c C T 10: 70,553,153 T503I probably benign Het
Fbxo43 T A 15: 36,161,867 Q398L probably benign Het
Fbxo44 A G 4: 148,158,632 I57T probably benign Het
Flnc T C 6: 29,449,370 I1422T probably benign Het
Flrt2 T C 12: 95,779,302 L138P probably damaging Het
Frem3 A G 8: 80,612,211 K378E possibly damaging Het
Ganc T A 2: 120,422,079 D128E probably benign Het
Gm19965 T C 1: 116,821,785 S399P Het
H2-Q1 A T 17: 35,321,021 K89* probably null Het
H2-Q2 A T 17: 35,342,325 probably benign Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Homer2 T A 7: 81,624,266 S125C possibly damaging Het
Hormad2 T C 11: 4,408,714 K231R probably benign Het
Kif17 A C 4: 138,277,909 K262Q probably damaging Het
Kif20a G A 18: 34,628,391 S279N probably benign Het
Lrp12 T C 15: 39,878,054 N441D probably damaging Het
Lta4h G T 10: 93,482,264 L515F possibly damaging Het
Mavs T C 2: 131,246,550 S425P probably benign Het
Mcat A C 15: 83,555,391 D99E probably damaging Het
Nav2 C A 7: 49,546,017 T1047K probably benign Het
Neb T A 2: 52,209,645 Y4731F probably damaging Het
Nectin4 G C 1: 171,383,757 R283P probably null Het
Notch3 G A 17: 32,158,112 T273I probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr1415 T G 1: 92,491,525 I77L possibly damaging Het
Olfr152 A T 2: 87,783,486 *317C probably null Het
Olfr5 T A 7: 6,480,869 I96F possibly damaging Het
Pcdha12 A T 18: 37,022,585 T786S probably benign Het
Pde9a A G 17: 31,473,212 K520E probably benign Het
Piezo2 A C 18: 63,075,730 L1404R probably damaging Het
Rrbp1 T C 2: 143,950,496 S1321G probably benign Het
Rtkn T C 6: 83,151,916 V464A probably damaging Het
Rtn4rl1 T C 11: 75,265,321 F193S probably damaging Het
Samd4 G A 14: 46,884,917 V33I probably damaging Het
Scn5a A G 9: 119,521,291 L839P probably damaging Het
Slc6a17 C A 3: 107,473,669 V507L probably benign Het
Stradb C A 1: 58,991,197 N203K unknown Het
Tenm2 T C 11: 36,069,369 T1044A possibly damaging Het
Tmem245 A C 4: 56,886,037 W860G probably damaging Het
Trappc10 C T 10: 78,200,626 D920N possibly damaging Het
Vmn1r59 T A 7: 5,453,967 I265L probably benign Het
Zbtb20 A C 16: 43,618,737 D667A probably damaging Het
Zbtb4 T A 11: 69,777,483 I344N probably damaging Het
Zdbf2 T A 1: 63,304,075 C538S possibly damaging Het
Zmym6 A T 4: 127,122,562 H712L probably damaging Het
Other mutations in Tpst2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01727:Tpst2 APN 5 112309858 missense probably damaging 1.00
IGL03268:Tpst2 APN 5 112308225 missense probably damaging 1.00
blooming UTSW 5 112307757 missense probably benign
gypsum UTSW 5 112308045 missense probably damaging 1.00
hot_springs UTSW 5 112307678 missense probably benign 0.05
R1175:Tpst2 UTSW 5 112308045 missense probably damaging 1.00
R1423:Tpst2 UTSW 5 112307622 missense probably benign 0.22
R1537:Tpst2 UTSW 5 112308420 missense possibly damaging 0.48
R2013:Tpst2 UTSW 5 112308014 missense probably damaging 1.00
R4624:Tpst2 UTSW 5 112308296 missense probably damaging 1.00
R4873:Tpst2 UTSW 5 112309821 nonsense probably null
R4875:Tpst2 UTSW 5 112309821 nonsense probably null
R5272:Tpst2 UTSW 5 112307952 missense probably damaging 1.00
R6123:Tpst2 UTSW 5 112308218 missense probably damaging 1.00
R6487:Tpst2 UTSW 5 112308123 missense probably damaging 1.00
R6605:Tpst2 UTSW 5 112276734 start gained probably benign
R6688:Tpst2 UTSW 5 112307757 missense probably benign
R7240:Tpst2 UTSW 5 112307678 missense probably benign 0.05
R7625:Tpst2 UTSW 5 112308021 missense probably damaging 1.00
R7777:Tpst2 UTSW 5 112309694 missense possibly damaging 0.53
R7797:Tpst2 UTSW 5 112307916 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGCAGCAAGTACTGGAG -3'
(R):5'- TGAAGGGGTCCTTGTTACACAG -3'

Sequencing Primer
(F):5'- CAGCAAGTACTGGAGTGCCG -3'
(R):5'- TTGTTACACAGCACGCGG -3'
Posted On2020-07-28