Incidental Mutation 'R8306:Brca2'
ID641062
Institutional Source Beutler Lab
Gene Symbol Brca2
Ensembl Gene ENSMUSG00000041147
Gene Namebreast cancer 2, early onset
SynonymsFancd1, RAB163
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8306 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location150522630-150570329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 150536663 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 468 (E468K)
Ref Sequence ENSEMBL: ENSMUSP00000144676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044620] [ENSMUST00000202003] [ENSMUST00000202313]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044620
AA Change: E468K

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038576
Gene: ENSMUSG00000041147
AA Change: E468K

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Pfam:BRCA2 982 1014 2.6e-13 PFAM
Pfam:BRCA2 1193 1225 3.9e-16 PFAM
low complexity region 1239 1252 N/A INTRINSIC
Pfam:BRCA2 1395 1425 1.4e-13 PFAM
Pfam:BRCA2 1492 1524 1.8e-13 PFAM
Pfam:BRCA2 1624 1655 8.4e-12 PFAM
Pfam:BRCA2 1925 1957 8e-15 PFAM
Pfam:BRCA2 2005 2037 1.7e-11 PFAM
Pfam:BRCA-2_helical 2402 2588 1.3e-94 PFAM
Pfam:BRCA-2_OB1 2591 2717 5.3e-44 PFAM
Tower 2752 2793 2.37e-18 SMART
Pfam:BRCA-2_OB3 2971 3104 1.5e-49 PFAM
low complexity region 3197 3208 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202003
AA Change: E468K

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144676
Gene: ENSMUSG00000041147
AA Change: E468K

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202313
AA Change: E468K

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144150
Gene: ENSMUSG00000041147
AA Change: E468K

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Pfam:BRCA2 982 1014 2.6e-13 PFAM
Pfam:BRCA2 1193 1225 3.9e-16 PFAM
low complexity region 1239 1252 N/A INTRINSIC
Pfam:BRCA2 1395 1425 1.4e-13 PFAM
Pfam:BRCA2 1492 1524 1.8e-13 PFAM
Pfam:BRCA2 1624 1655 8.4e-12 PFAM
Pfam:BRCA2 1925 1957 8e-15 PFAM
Pfam:BRCA2 2005 2037 1.7e-11 PFAM
Pfam:BRCA-2_helical 2402 2588 1.3e-94 PFAM
Pfam:BRCA-2_OB1 2591 2717 5.3e-44 PFAM
Tower 2752 2793 2.37e-18 SMART
Pfam:BRCA-2_OB3 2971 3104 1.5e-49 PFAM
low complexity region 3197 3208 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA2 protein survive, are small, infertile, show improper tissue differentiation and develop lymphomas and carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 C A 11: 101,411,368 V158F probably damaging Het
Adam1b T C 5: 121,503,149 probably benign Het
Ambn G A 5: 88,459,422 E50K possibly damaging Het
Ash1l A G 3: 88,965,952 D14G probably benign Het
Asphd1 C T 7: 126,948,612 R173H probably damaging Het
Atr A T 9: 95,920,370 T1772S Het
Best3 T C 10: 117,002,610 L191P probably damaging Het
Bola1 A T 3: 96,197,201 S26T probably benign Het
Borcs6 T C 11: 69,059,820 L8P probably benign Het
Brca1 T G 11: 101,525,637 Q557P probably damaging Het
Btbd11 T A 10: 85,598,545 C22* probably null Het
Capza2 T A 6: 17,637,132 L4Q probably benign Het
Cc2d2b T A 19: 40,815,784 Y918* probably null Het
Ccdc163 T C 4: 116,710,275 L67P probably damaging Het
Ccdc172 C A 19: 58,536,590 Q160K probably damaging Het
Ccp110 T A 7: 118,722,680 D519E probably benign Het
Cd300ld2 T C 11: 115,013,822 Q73R probably benign Het
Cfap46 T A 7: 139,656,580 D608V Het
Cfap69 T G 5: 5,604,287 Y549S probably benign Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Clu A C 14: 65,979,762 Q348P probably damaging Het
Cnot1 A T 8: 95,747,021 N1153K probably benign Het
Col2a1 T C 15: 97,990,968 probably null Het
Col6a6 A T 9: 105,784,073 I279N probably damaging Het
Dopey1 A G 9: 86,520,206 D1153G possibly damaging Het
Dpyd A G 3: 119,412,173 K888E probably benign Het
Eif2ak4 T C 2: 118,457,175 I1208T possibly damaging Het
Epha1 T C 6: 42,358,788 I972V probably damaging Het
Fam13c C T 10: 70,553,153 T503I probably benign Het
Fbxo43 T A 15: 36,161,867 Q398L probably benign Het
Fbxo44 A G 4: 148,158,632 I57T probably benign Het
Flnc T C 6: 29,449,370 I1422T probably benign Het
Flrt2 T C 12: 95,779,302 L138P probably damaging Het
Frem3 A G 8: 80,612,211 K378E possibly damaging Het
Ganc T A 2: 120,422,079 D128E probably benign Het
Gm19965 T C 1: 116,821,785 S399P Het
H2-Q1 A T 17: 35,321,021 K89* probably null Het
H2-Q2 A T 17: 35,342,325 probably benign Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Homer2 T A 7: 81,624,266 S125C possibly damaging Het
Hormad2 T C 11: 4,408,714 K231R probably benign Het
Kif17 A C 4: 138,277,909 K262Q probably damaging Het
Kif20a G A 18: 34,628,391 S279N probably benign Het
Lrp12 T C 15: 39,878,054 N441D probably damaging Het
Lta4h G T 10: 93,482,264 L515F possibly damaging Het
Mavs T C 2: 131,246,550 S425P probably benign Het
Mcat A C 15: 83,555,391 D99E probably damaging Het
Nav2 C A 7: 49,546,017 T1047K probably benign Het
Neb T A 2: 52,209,645 Y4731F probably damaging Het
Nectin4 G C 1: 171,383,757 R283P probably null Het
Notch3 G A 17: 32,158,112 T273I probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr1415 T G 1: 92,491,525 I77L possibly damaging Het
Olfr152 A T 2: 87,783,486 *317C probably null Het
Olfr5 T A 7: 6,480,869 I96F possibly damaging Het
Pcdha12 A T 18: 37,022,585 T786S probably benign Het
Pde9a A G 17: 31,473,212 K520E probably benign Het
Piezo2 A C 18: 63,075,730 L1404R probably damaging Het
Rrbp1 T C 2: 143,950,496 S1321G probably benign Het
Rtkn T C 6: 83,151,916 V464A probably damaging Het
Rtn4rl1 T C 11: 75,265,321 F193S probably damaging Het
Samd4 G A 14: 46,884,917 V33I probably damaging Het
Scn5a A G 9: 119,521,291 L839P probably damaging Het
Slc6a17 C A 3: 107,473,669 V507L probably benign Het
Stradb C A 1: 58,991,197 N203K unknown Het
Tenm2 T C 11: 36,069,369 T1044A possibly damaging Het
Tmem245 A C 4: 56,886,037 W860G probably damaging Het
Tpst2 G A 5: 112,307,937 R114H probably damaging Het
Trappc10 C T 10: 78,200,626 D920N possibly damaging Het
Vmn1r59 T A 7: 5,453,967 I265L probably benign Het
Zbtb20 A C 16: 43,618,737 D667A probably damaging Het
Zbtb4 T A 11: 69,777,483 I344N probably damaging Het
Zdbf2 T A 1: 63,304,075 C538S possibly damaging Het
Zmym6 A T 4: 127,122,562 H712L probably damaging Het
Other mutations in Brca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Brca2 APN 5 150539898 missense probably benign 0.18
IGL00392:Brca2 APN 5 150541240 missense probably benign 0.02
IGL00557:Brca2 APN 5 150560538 missense probably benign
IGL00798:Brca2 APN 5 150539463 missense probably benign 0.30
IGL00933:Brca2 APN 5 150542404 missense probably benign 0.04
IGL00964:Brca2 APN 5 150532310 missense probably damaging 1.00
IGL01152:Brca2 APN 5 150542390 missense probably damaging 0.99
IGL01577:Brca2 APN 5 150541620 nonsense probably null
IGL01585:Brca2 APN 5 150539516 missense possibly damaging 0.76
IGL01732:Brca2 APN 5 150542387 missense probably benign 0.13
IGL01809:Brca2 APN 5 150531061 splice site probably null
IGL01911:Brca2 APN 5 150567613 missense probably damaging 0.96
IGL02113:Brca2 APN 5 150540979 missense possibly damaging 0.95
IGL02313:Brca2 APN 5 150538661 missense probably damaging 1.00
IGL02342:Brca2 APN 5 150542824 missense possibly damaging 0.94
IGL02508:Brca2 APN 5 150543308 missense possibly damaging 0.85
IGL02532:Brca2 APN 5 150550862 missense probably damaging 1.00
IGL02646:Brca2 APN 5 150560790 missense possibly damaging 0.89
IGL02738:Brca2 APN 5 150567035 missense probably damaging 1.00
IGL02833:Brca2 APN 5 150541790 missense possibly damaging 0.83
IGL02871:Brca2 APN 5 150542552 missense probably benign 0.13
IGL02995:Brca2 APN 5 150529488 missense probably damaging 1.00
IGL03105:Brca2 APN 5 150560485 missense probably benign 0.02
BB007:Brca2 UTSW 5 150558510 missense probably damaging 0.96
BB017:Brca2 UTSW 5 150558510 missense probably damaging 0.96
R0219:Brca2 UTSW 5 150523175 splice site probably benign
R0416:Brca2 UTSW 5 150569392 missense possibly damaging 0.93
R0441:Brca2 UTSW 5 150541857 missense probably damaging 0.96
R0548:Brca2 UTSW 5 150544935 missense probably damaging 0.96
R0745:Brca2 UTSW 5 150544882 splice site probably benign
R0799:Brca2 UTSW 5 150560193 missense probably damaging 0.99
R1165:Brca2 UTSW 5 150542747 missense probably damaging 0.98
R1247:Brca2 UTSW 5 150541274 missense probably damaging 1.00
R1403:Brca2 UTSW 5 150542649 missense probably benign 0.22
R1403:Brca2 UTSW 5 150542649 missense probably benign 0.22
R1444:Brca2 UTSW 5 150542450 missense probably benign
R1466:Brca2 UTSW 5 150552258 missense probably damaging 0.99
R1466:Brca2 UTSW 5 150552258 missense probably damaging 0.99
R1584:Brca2 UTSW 5 150552258 missense probably damaging 0.99
R1599:Brca2 UTSW 5 150548713 nonsense probably null
R1600:Brca2 UTSW 5 150560830 splice site probably benign
R1822:Brca2 UTSW 5 150540198 missense probably benign 0.06
R1824:Brca2 UTSW 5 150536922 missense possibly damaging 0.94
R2037:Brca2 UTSW 5 150540669 missense probably benign
R2131:Brca2 UTSW 5 150557129 missense probably damaging 1.00
R2203:Brca2 UTSW 5 150539502 missense possibly damaging 0.58
R2208:Brca2 UTSW 5 150532344 missense probably damaging 0.96
R2293:Brca2 UTSW 5 150560534 missense possibly damaging 0.86
R2517:Brca2 UTSW 5 150539672 missense probably benign 0.04
R2566:Brca2 UTSW 5 150541762 missense probably benign 0.03
R3422:Brca2 UTSW 5 150543121 missense possibly damaging 0.91
R3917:Brca2 UTSW 5 150540827 missense probably damaging 0.96
R3946:Brca2 UTSW 5 150536704 missense probably damaging 0.96
R4176:Brca2 UTSW 5 150539633 nonsense probably null
R4255:Brca2 UTSW 5 150541169 missense possibly damaging 0.92
R4450:Brca2 UTSW 5 150536053 missense probably damaging 0.96
R4603:Brca2 UTSW 5 150536165 missense possibly damaging 0.86
R4681:Brca2 UTSW 5 150552398 splice site probably null
R4755:Brca2 UTSW 5 150559987 splice site probably null
R4762:Brca2 UTSW 5 150531116 missense probably benign 0.00
R4824:Brca2 UTSW 5 150539735 missense probably damaging 1.00
R4887:Brca2 UTSW 5 150556937 missense probably damaging 1.00
R5020:Brca2 UTSW 5 150560436 missense probably damaging 1.00
R5159:Brca2 UTSW 5 150542108 missense possibly damaging 0.93
R5216:Brca2 UTSW 5 150542980 missense probably damaging 0.99
R5269:Brca2 UTSW 5 150539223 missense possibly damaging 0.75
R5274:Brca2 UTSW 5 150539689 missense probably benign 0.00
R5589:Brca2 UTSW 5 150557132 missense possibly damaging 0.67
R5619:Brca2 UTSW 5 150557114 missense probably damaging 0.96
R5641:Brca2 UTSW 5 150556899 missense probably damaging 1.00
R5686:Brca2 UTSW 5 150540904 missense probably benign 0.00
R5730:Brca2 UTSW 5 150569005 missense possibly damaging 0.85
R5763:Brca2 UTSW 5 150548006 missense possibly damaging 0.85
R5877:Brca2 UTSW 5 150543221 missense possibly damaging 0.53
R5893:Brca2 UTSW 5 150569138 missense probably benign 0.02
R5900:Brca2 UTSW 5 150541132 missense probably benign 0.01
R5926:Brca2 UTSW 5 150534622 missense probably benign 0.07
R5966:Brca2 UTSW 5 150543251 missense probably damaging 0.99
R6025:Brca2 UTSW 5 150541575 frame shift probably null
R6062:Brca2 UTSW 5 150556889 missense probably damaging 0.96
R6141:Brca2 UTSW 5 150540637 missense possibly damaging 0.91
R6244:Brca2 UTSW 5 150566978 missense probably benign 0.08
R6508:Brca2 UTSW 5 150536593 missense possibly damaging 0.91
R6519:Brca2 UTSW 5 150540979 missense probably damaging 0.99
R6611:Brca2 UTSW 5 150536193 missense probably damaging 0.99
R6698:Brca2 UTSW 5 150532394 missense probably damaging 1.00
R6856:Brca2 UTSW 5 150540208 missense possibly damaging 0.68
R6912:Brca2 UTSW 5 150541742 missense probably damaging 0.99
R7002:Brca2 UTSW 5 150539918 missense probably benign
R7025:Brca2 UTSW 5 150540478 missense probably benign 0.39
R7151:Brca2 UTSW 5 150541436 missense probably benign 0.12
R7202:Brca2 UTSW 5 150532354 missense probably benign 0.03
R7365:Brca2 UTSW 5 150532337 missense probably damaging 0.99
R7510:Brca2 UTSW 5 150536691 missense possibly damaging 0.85
R7612:Brca2 UTSW 5 150540611 missense probably benign 0.03
R7682:Brca2 UTSW 5 150543153 missense probably benign
R7890:Brca2 UTSW 5 150539381 missense possibly damaging 0.83
R7930:Brca2 UTSW 5 150558510 missense probably damaging 0.96
R7940:Brca2 UTSW 5 150538733 missense probably benign
R8054:Brca2 UTSW 5 150536504 missense probably benign 0.02
R8056:Brca2 UTSW 5 150569306 missense possibly damaging 0.85
R8080:Brca2 UTSW 5 150539892 missense probably benign 0.11
R8094:Brca2 UTSW 5 150536169 missense possibly damaging 0.85
R8401:Brca2 UTSW 5 150552352 missense probably damaging 1.00
R8523:Brca2 UTSW 5 150560148 missense possibly damaging 0.75
R8784:Brca2 UTSW 5 150548661 nonsense probably null
R8791:Brca2 UTSW 5 150542596 missense possibly damaging 0.92
R8832:Brca2 UTSW 5 150542146 missense possibly damaging 0.91
R8838:Brca2 UTSW 5 150541540 missense possibly damaging 0.91
R8845:Brca2 UTSW 5 150543382 missense possibly damaging 0.85
R8898:Brca2 UTSW 5 150569033 missense possibly damaging 0.53
R8914:Brca2 UTSW 5 150541743 missense probably damaging 0.96
Z1088:Brca2 UTSW 5 150542763 missense probably damaging 0.96
Z1186:Brca2 UTSW 5 150536583 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGTCTAAATGAAACCCAGACAG -3'
(R):5'- TGCAGAGGCTTCATGTTCTTC -3'

Sequencing Primer
(F):5'- CAGACAGGAAAAATAACCTTACCTC -3'
(R):5'- CAGAGGCTTCATGTTCTTCTGTAAAG -3'
Posted On2020-07-28