Incidental Mutation 'R8306:Rtkn'
ID 641066
Institutional Source Beutler Lab
Gene Symbol Rtkn
Ensembl Gene ENSMUSG00000034930
Gene Name rhotekin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock # R8306 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 83135463-83152579 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 83151916 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 464 (V464A)
Ref Sequence ENSEMBL: ENSMUSP00000065571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032106] [ENSMUST00000065512] [ENSMUST00000087938] [ENSMUST00000121093] [ENSMUST00000125894] [ENSMUST00000129316] [ENSMUST00000130622] [ENSMUST00000135490] [ENSMUST00000153148] [ENSMUST00000203203]
AlphaFold Q8C6B2
Predicted Effect probably benign
Transcript: ENSMUST00000032106
SMART Domains Protein: ENSMUSP00000032106
Gene: ENSMUSG00000030030

DomainStartEndE-ValueType
Pfam:DUF4639 6 571 3.7e-266 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000065512
AA Change: V464A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065571
Gene: ENSMUSG00000034930
AA Change: V464A

DomainStartEndE-ValueType
Hr1 36 99 5.65e-13 SMART
Pfam:Anillin 117 270 8.3e-46 PFAM
PH 310 418 2.3e-4 SMART
low complexity region 490 505 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087938
AA Change: V451A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085249
Gene: ENSMUSG00000034930
AA Change: V451A

DomainStartEndE-ValueType
Hr1 23 86 1.62e-13 SMART
Pfam:Anillin 103 258 8e-25 PFAM
PH 297 405 2.3e-4 SMART
low complexity region 477 492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121093
AA Change: V451A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112501
Gene: ENSMUSG00000034930
AA Change: V451A

DomainStartEndE-ValueType
Hr1 23 86 1.62e-13 SMART
Pfam:Anillin 103 258 8e-25 PFAM
PH 297 405 2.3e-4 SMART
low complexity region 477 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125894
SMART Domains Protein: ENSMUSP00000122873
Gene: ENSMUSG00000030032

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129316
SMART Domains Protein: ENSMUSP00000120640
Gene: ENSMUSG00000034930

DomainStartEndE-ValueType
Blast:Hr1 1 49 6e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000130622
SMART Domains Protein: ENSMUSP00000122660
Gene: ENSMUSG00000034930

DomainStartEndE-ValueType
Hr1 55 118 1.97e-12 SMART
Pfam:Anillin 135 217 2.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135490
SMART Domains Protein: ENSMUSP00000116964
Gene: ENSMUSG00000034930

DomainStartEndE-ValueType
Blast:Hr1 1 49 2e-25 BLAST
Pfam:Anillin 66 221 1.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153148
SMART Domains Protein: ENSMUSP00000116608
Gene: ENSMUSG00000030032

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
WD40 153 197 5.92e1 SMART
WD40 201 238 3.55e1 SMART
WD40 241 280 1.79e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203203
SMART Domains Protein: ENSMUSP00000145406
Gene: ENSMUSG00000030030

DomainStartEndE-ValueType
Pfam:DUF4639 6 82 1.4e-52 PFAM
low complexity region 90 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213056
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein that interacts with GTP-bound Rho proteins. Binding of this protein inhibits the GTPase activity of Rho proteins. This protein may interfere with the conversion of active, GTP-bound Rho to the inactive GDP-bound form by RhoGAP. Rho proteins regulate many important cellular processes, including cytokinesis, transcription, smooth muscle contraction, cell growth and transformation. Dysregulation of the Rho signal transduction pathway has been implicated in many forms of cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 C A 11: 101,411,368 V158F probably damaging Het
Adam1b T C 5: 121,503,149 probably benign Het
Ambn G A 5: 88,459,422 E50K possibly damaging Het
Ash1l A G 3: 88,965,952 D14G probably benign Het
Asphd1 C T 7: 126,948,612 R173H probably damaging Het
Atr A T 9: 95,920,370 T1772S Het
Best3 T C 10: 117,002,610 L191P probably damaging Het
Bola1 A T 3: 96,197,201 S26T probably benign Het
Borcs6 T C 11: 69,059,820 L8P probably benign Het
Brca1 T G 11: 101,525,637 Q557P probably damaging Het
Brca2 G A 5: 150,536,663 E468K possibly damaging Het
Btbd11 T A 10: 85,598,545 C22* probably null Het
Capza2 T A 6: 17,637,132 L4Q probably benign Het
Cc2d2b T A 19: 40,815,784 Y918* probably null Het
Ccdc163 T C 4: 116,710,275 L67P probably damaging Het
Ccdc172 C A 19: 58,536,590 Q160K probably damaging Het
Ccp110 T A 7: 118,722,680 D519E probably benign Het
Cd300ld2 T C 11: 115,013,822 Q73R probably benign Het
Cfap46 T A 7: 139,656,580 D608V Het
Cfap69 T G 5: 5,604,287 Y549S probably benign Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Clu A C 14: 65,979,762 Q348P probably damaging Het
Cnot1 A T 8: 95,747,021 N1153K probably benign Het
Col2a1 T C 15: 97,990,968 probably null Het
Col6a6 A T 9: 105,784,073 I279N probably damaging Het
Dopey1 A G 9: 86,520,206 D1153G possibly damaging Het
Dpyd A G 3: 119,412,173 K888E probably benign Het
Eif2ak4 T C 2: 118,457,175 I1208T possibly damaging Het
Epha1 T C 6: 42,358,788 I972V probably damaging Het
Fam13c C T 10: 70,553,153 T503I probably benign Het
Fbxo43 T A 15: 36,161,867 Q398L probably benign Het
Fbxo44 A G 4: 148,158,632 I57T probably benign Het
Flnc T C 6: 29,449,370 I1422T probably benign Het
Flrt2 T C 12: 95,779,302 L138P probably damaging Het
Frem3 A G 8: 80,612,211 K378E possibly damaging Het
Ganc T A 2: 120,422,079 D128E probably benign Het
Gm19965 T C 1: 116,821,785 S399P Het
H2-Q1 A T 17: 35,321,021 K89* probably null Het
H2-Q2 A T 17: 35,342,325 probably benign Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Homer2 T A 7: 81,624,266 S125C possibly damaging Het
Hormad2 T C 11: 4,408,714 K231R probably benign Het
Kif17 A C 4: 138,277,909 K262Q probably damaging Het
Kif20a G A 18: 34,628,391 S279N probably benign Het
Lrp12 T C 15: 39,878,054 N441D probably damaging Het
Lta4h G T 10: 93,482,264 L515F possibly damaging Het
Mavs T C 2: 131,246,550 S425P probably benign Het
Mcat A C 15: 83,555,391 D99E probably damaging Het
Nav2 C A 7: 49,546,017 T1047K probably benign Het
Neb T A 2: 52,209,645 Y4731F probably damaging Het
Nectin4 G C 1: 171,383,757 R283P probably null Het
Notch3 G A 17: 32,158,112 T273I probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr1415 T G 1: 92,491,525 I77L possibly damaging Het
Olfr152 A T 2: 87,783,486 *317C probably null Het
Olfr5 T A 7: 6,480,869 I96F possibly damaging Het
Pcdha12 A T 18: 37,022,585 T786S probably benign Het
Pde9a A G 17: 31,473,212 K520E probably benign Het
Piezo2 A C 18: 63,075,730 L1404R probably damaging Het
Rrbp1 T C 2: 143,950,496 S1321G probably benign Het
Rtn4rl1 T C 11: 75,265,321 F193S probably damaging Het
Samd4 G A 14: 46,884,917 V33I probably damaging Het
Scn5a A G 9: 119,521,291 L839P probably damaging Het
Slc6a17 C A 3: 107,473,669 V507L probably benign Het
Stradb C A 1: 58,991,197 N203K unknown Het
Tenm2 T C 11: 36,069,369 T1044A possibly damaging Het
Tmem245 A C 4: 56,886,037 W860G probably damaging Het
Tpst2 G A 5: 112,307,937 R114H probably damaging Het
Trappc10 C T 10: 78,200,626 D920N possibly damaging Het
Vmn1r59 T A 7: 5,453,967 I265L probably benign Het
Zbtb20 A C 16: 43,618,737 D667A probably damaging Het
Zbtb4 T A 11: 69,777,483 I344N probably damaging Het
Zdbf2 T A 1: 63,304,075 C538S possibly damaging Het
Zmym6 A T 4: 127,122,562 H712L probably damaging Het
Other mutations in Rtkn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Rtkn APN 6 83146061 missense probably damaging 1.00
IGL02265:Rtkn APN 6 83147542 missense probably damaging 1.00
IGL02551:Rtkn APN 6 83151924 missense probably damaging 1.00
IGL03028:Rtkn APN 6 83147872 nonsense probably null
IGL03388:Rtkn APN 6 83150090 missense probably benign 0.02
R1648:Rtkn UTSW 6 83135994 missense probably damaging 1.00
R2100:Rtkn UTSW 6 83149560 splice site probably null
R2517:Rtkn UTSW 6 83147545 missense probably damaging 1.00
R3608:Rtkn UTSW 6 83150035 missense probably damaging 0.97
R3946:Rtkn UTSW 6 83135976 missense probably benign 0.01
R4170:Rtkn UTSW 6 83142395 start codon destroyed probably null
R4630:Rtkn UTSW 6 83152182 nonsense probably null
R5044:Rtkn UTSW 6 83150991 missense probably benign 0.01
R5102:Rtkn UTSW 6 83149773 missense probably damaging 0.98
R6165:Rtkn UTSW 6 83145963 missense probably damaging 1.00
R6372:Rtkn UTSW 6 83151901 missense possibly damaging 0.96
R7101:Rtkn UTSW 6 83150012 missense possibly damaging 0.76
R7155:Rtkn UTSW 6 83149711 missense probably damaging 0.99
R7251:Rtkn UTSW 6 83135962 missense probably damaging 1.00
R7381:Rtkn UTSW 6 83151745 missense probably damaging 0.97
R7598:Rtkn UTSW 6 83147903 missense probably null 0.96
R7624:Rtkn UTSW 6 83152177 missense probably benign
R8935:Rtkn UTSW 6 83138215 missense probably damaging 1.00
R9094:Rtkn UTSW 6 83151037 missense possibly damaging 0.92
R9169:Rtkn UTSW 6 83152209 missense probably damaging 1.00
R9252:Rtkn UTSW 6 83148162 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTCTTATCAGAACCTGTGG -3'
(R):5'- CAGCATCCAGGGAAAAGGTTC -3'

Sequencing Primer
(F):5'- TATCAGAACCTGTGGCCTCCG -3'
(R):5'- AAAAGGTTCGGGGTCTTCC -3'
Posted On 2020-07-28