Incidental Mutation 'R8306:Nav2'
ID 641069
Institutional Source Beutler Lab
Gene Symbol Nav2
Ensembl Gene ENSMUSG00000052512
Gene Name neuron navigator 2
Synonyms Rainb1, Unc53H2, 5330421F07Rik, POMFIL2, HELAD1, RAINB2
MMRRC Submission 067792-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.550) question?
Stock # R8306 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 48608796-49259838 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 49195765 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 1047 (T1047K)
Ref Sequence ENSEMBL: ENSMUSP00000067448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064395] [ENSMUST00000183659] [ENSMUST00000184109] [ENSMUST00000184945]
AlphaFold E9Q842
Predicted Effect probably benign
Transcript: ENSMUST00000064395
AA Change: T1047K

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000067448
Gene: ENSMUSG00000052512
AA Change: T1047K

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183659
AA Change: T986K

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139309
Gene: ENSMUSG00000052512
AA Change: T986K

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
CH 23 126 6.19e-16 SMART
low complexity region 141 149 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
coiled coil region 425 455 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
low complexity region 552 564 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
low complexity region 859 883 N/A INTRINSIC
low complexity region 886 906 N/A INTRINSIC
low complexity region 929 943 N/A INTRINSIC
low complexity region 1001 1013 N/A INTRINSIC
low complexity region 1282 1299 N/A INTRINSIC
low complexity region 1307 1324 N/A INTRINSIC
low complexity region 1356 1371 N/A INTRINSIC
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1465 1479 N/A INTRINSIC
low complexity region 1553 1567 N/A INTRINSIC
coiled coil region 1569 1656 N/A INTRINSIC
low complexity region 1728 1739 N/A INTRINSIC
coiled coil region 1780 1848 N/A INTRINSIC
AAA 2032 2186 1.69e-5 SMART
low complexity region 2343 2369 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184109
SMART Domains Protein: ENSMUSP00000138846
Gene: ENSMUSG00000052512

DomainStartEndE-ValueType
low complexity region 154 171 N/A INTRINSIC
low complexity region 179 196 N/A INTRINSIC
low complexity region 228 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184945
AA Change: T1047K

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139045
Gene: ENSMUSG00000052512
AA Change: T1047K

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuron navigator gene family, which may play a role in cellular growth and migration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display impaired olfaction and hearing, increased latency in a hot plate test, degeneration of the optic nerve, decreased exploration in new environments, and weight loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 C A 11: 101,302,194 (GRCm39) V158F probably damaging Het
Abtb3 T A 10: 85,434,409 (GRCm39) C22* probably null Het
Adam1b T C 5: 121,641,212 (GRCm39) probably benign Het
Ambn G A 5: 88,607,281 (GRCm39) E50K possibly damaging Het
Ash1l A G 3: 88,873,259 (GRCm39) D14G probably benign Het
Asphd1 C T 7: 126,547,784 (GRCm39) R173H probably damaging Het
Atr A T 9: 95,802,423 (GRCm39) T1772S Het
Best3 T C 10: 116,838,515 (GRCm39) L191P probably damaging Het
Bola1 A T 3: 96,104,517 (GRCm39) S26T probably benign Het
Borcs6 T C 11: 68,950,646 (GRCm39) L8P probably benign Het
Brca1 T G 11: 101,416,463 (GRCm39) Q557P probably damaging Het
Brca2 G A 5: 150,460,128 (GRCm39) E468K possibly damaging Het
Capza2 T A 6: 17,637,131 (GRCm39) L4Q probably benign Het
Cc2d2b T A 19: 40,804,228 (GRCm39) Y918* probably null Het
Ccdc163 T C 4: 116,567,472 (GRCm39) L67P probably damaging Het
Ccdc172 C A 19: 58,525,022 (GRCm39) Q160K probably damaging Het
Ccp110 T A 7: 118,321,903 (GRCm39) D519E probably benign Het
Cd300ld2 T C 11: 114,904,648 (GRCm39) Q73R probably benign Het
Cfap46 T A 7: 139,236,496 (GRCm39) D608V Het
Cfap69 T G 5: 5,654,287 (GRCm39) Y549S probably benign Het
Cilp G A 9: 65,186,286 (GRCm39) G794S probably damaging Het
Clu A C 14: 66,217,211 (GRCm39) Q348P probably damaging Het
Cnot1 A T 8: 96,473,649 (GRCm39) N1153K probably benign Het
Col2a1 T C 15: 97,888,849 (GRCm39) probably null Het
Col6a6 A T 9: 105,661,272 (GRCm39) I279N probably damaging Het
Dop1a A G 9: 86,402,259 (GRCm39) D1153G possibly damaging Het
Dpyd A G 3: 119,205,822 (GRCm39) K888E probably benign Het
Eif2ak4 T C 2: 118,287,656 (GRCm39) I1208T possibly damaging Het
Epha1 T C 6: 42,335,722 (GRCm39) I972V probably damaging Het
Fam13c C T 10: 70,388,983 (GRCm39) T503I probably benign Het
Fbxo43 T A 15: 36,162,013 (GRCm39) Q398L probably benign Het
Fbxo44 A G 4: 148,243,089 (GRCm39) I57T probably benign Het
Flnc T C 6: 29,449,369 (GRCm39) I1422T probably benign Het
Flrt2 T C 12: 95,746,076 (GRCm39) L138P probably damaging Het
Frem3 A G 8: 81,338,840 (GRCm39) K378E possibly damaging Het
Ganc T A 2: 120,252,560 (GRCm39) D128E probably benign Het
Gm19965 T C 1: 116,749,515 (GRCm39) S399P Het
H2-Q1 A T 17: 35,539,997 (GRCm39) K89* probably null Het
H2-Q2 A T 17: 35,561,301 (GRCm39) probably benign Het
Hmmr G A 11: 40,612,499 (GRCm39) S206F probably damaging Het
Homer2 T A 7: 81,274,014 (GRCm39) S125C possibly damaging Het
Hormad2 T C 11: 4,358,714 (GRCm39) K231R probably benign Het
Kif17 A C 4: 138,005,220 (GRCm39) K262Q probably damaging Het
Kif20a G A 18: 34,761,444 (GRCm39) S279N probably benign Het
Lrp12 T C 15: 39,741,450 (GRCm39) N441D probably damaging Het
Lta4h G T 10: 93,318,126 (GRCm39) L515F possibly damaging Het
Mavs T C 2: 131,088,470 (GRCm39) S425P probably benign Het
Mcat A C 15: 83,439,592 (GRCm39) D99E probably damaging Het
Neb T A 2: 52,099,657 (GRCm39) Y4731F probably damaging Het
Nectin4 G C 1: 171,211,325 (GRCm39) R283P probably null Het
Notch3 G A 17: 32,377,086 (GRCm39) T273I probably damaging Het
Or4c11c G A 2: 88,661,633 (GRCm39) M57I possibly damaging Het
Or5i1 A T 2: 87,613,830 (GRCm39) *317C probably null Het
Or6b2b T G 1: 92,419,247 (GRCm39) I77L possibly damaging Het
Or6z7 T A 7: 6,483,868 (GRCm39) I96F possibly damaging Het
Pcdha12 A T 18: 37,155,638 (GRCm39) T786S probably benign Het
Pde9a A G 17: 31,692,186 (GRCm39) K520E probably benign Het
Piezo2 A C 18: 63,208,801 (GRCm39) L1404R probably damaging Het
Rrbp1 T C 2: 143,792,416 (GRCm39) S1321G probably benign Het
Rtkn T C 6: 83,128,897 (GRCm39) V464A probably damaging Het
Rtn4rl1 T C 11: 75,156,147 (GRCm39) F193S probably damaging Het
Samd4 G A 14: 47,122,374 (GRCm39) V33I probably damaging Het
Scn5a A G 9: 119,350,357 (GRCm39) L839P probably damaging Het
Slc6a17 C A 3: 107,380,985 (GRCm39) V507L probably benign Het
Stradb C A 1: 59,030,356 (GRCm39) N203K unknown Het
Tenm2 T C 11: 35,960,196 (GRCm39) T1044A possibly damaging Het
Tmem245 A C 4: 56,886,037 (GRCm39) W860G probably damaging Het
Tpst2 G A 5: 112,455,803 (GRCm39) R114H probably damaging Het
Trappc10 C T 10: 78,036,460 (GRCm39) D920N possibly damaging Het
Vmn1r59 T A 7: 5,456,966 (GRCm39) I265L probably benign Het
Zbtb20 A C 16: 43,439,100 (GRCm39) D667A probably damaging Het
Zbtb4 T A 11: 69,668,309 (GRCm39) I344N probably damaging Het
Zdbf2 T A 1: 63,343,234 (GRCm39) C538S possibly damaging Het
Zmym6 A T 4: 127,016,355 (GRCm39) H712L probably damaging Het
Other mutations in Nav2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Nav2 APN 7 49,220,942 (GRCm39) missense probably damaging 1.00
IGL01150:Nav2 APN 7 49,102,269 (GRCm39) missense probably benign 0.17
IGL01649:Nav2 APN 7 49,225,477 (GRCm39) missense probably damaging 1.00
IGL01662:Nav2 APN 7 49,220,957 (GRCm39) missense probably damaging 1.00
IGL02297:Nav2 APN 7 49,243,977 (GRCm39) missense probably damaging 0.98
IGL02313:Nav2 APN 7 49,208,521 (GRCm39) missense probably damaging 0.99
IGL02441:Nav2 APN 7 49,102,260 (GRCm39) missense probably damaging 1.00
IGL02472:Nav2 APN 7 49,195,789 (GRCm39) missense probably damaging 1.00
IGL02477:Nav2 APN 7 49,232,623 (GRCm39) missense probably damaging 0.99
IGL02725:Nav2 APN 7 49,214,843 (GRCm39) missense probably damaging 1.00
IGL02944:Nav2 APN 7 49,070,004 (GRCm39) missense probably damaging 0.99
IGL02953:Nav2 APN 7 49,198,171 (GRCm39) missense probably damaging 1.00
IGL03105:Nav2 APN 7 49,114,627 (GRCm39) missense probably damaging 1.00
IGL03234:Nav2 APN 7 49,111,756 (GRCm39) missense possibly damaging 0.94
IGL03274:Nav2 APN 7 49,011,847 (GRCm39) missense probably damaging 1.00
IGL03294:Nav2 APN 7 49,141,205 (GRCm39) nonsense probably null
R0006:Nav2 UTSW 7 49,102,978 (GRCm39) missense possibly damaging 0.50
R0070:Nav2 UTSW 7 49,220,462 (GRCm39) missense probably damaging 1.00
R0113:Nav2 UTSW 7 49,185,701 (GRCm39) missense probably damaging 1.00
R0306:Nav2 UTSW 7 49,195,651 (GRCm39) missense probably benign 0.01
R0346:Nav2 UTSW 7 49,254,333 (GRCm39) missense probably benign 0.11
R0539:Nav2 UTSW 7 49,111,686 (GRCm39) missense probably damaging 1.00
R0669:Nav2 UTSW 7 49,058,431 (GRCm39) missense probably damaging 1.00
R0785:Nav2 UTSW 7 49,070,081 (GRCm39) missense probably benign 0.06
R0970:Nav2 UTSW 7 49,233,901 (GRCm39) missense probably damaging 1.00
R1162:Nav2 UTSW 7 49,185,788 (GRCm39) splice site probably benign
R1274:Nav2 UTSW 7 49,254,178 (GRCm39) nonsense probably null
R1463:Nav2 UTSW 7 49,185,710 (GRCm39) missense probably damaging 1.00
R1464:Nav2 UTSW 7 49,011,952 (GRCm39) missense probably damaging 1.00
R1464:Nav2 UTSW 7 49,011,952 (GRCm39) missense probably damaging 1.00
R1536:Nav2 UTSW 7 49,195,682 (GRCm39) missense probably damaging 1.00
R1612:Nav2 UTSW 7 49,220,959 (GRCm39) missense probably damaging 1.00
R1638:Nav2 UTSW 7 49,102,213 (GRCm39) missense probably benign
R1731:Nav2 UTSW 7 49,197,922 (GRCm39) missense probably damaging 1.00
R1734:Nav2 UTSW 7 49,225,468 (GRCm39) missense probably damaging 1.00
R1865:Nav2 UTSW 7 49,197,943 (GRCm39) missense possibly damaging 0.95
R1945:Nav2 UTSW 7 49,114,620 (GRCm39) missense probably damaging 1.00
R1997:Nav2 UTSW 7 49,198,219 (GRCm39) missense probably benign 0.16
R2061:Nav2 UTSW 7 49,248,645 (GRCm39) splice site probably benign
R2117:Nav2 UTSW 7 49,114,328 (GRCm39) missense probably benign 0.00
R2174:Nav2 UTSW 7 49,102,411 (GRCm39) missense probably damaging 0.99
R2182:Nav2 UTSW 7 49,247,002 (GRCm39) missense probably benign 0.38
R2251:Nav2 UTSW 7 49,103,025 (GRCm39) missense probably damaging 1.00
R2283:Nav2 UTSW 7 49,141,152 (GRCm39) missense probably damaging 1.00
R2343:Nav2 UTSW 7 49,248,565 (GRCm39) missense possibly damaging 0.82
R2472:Nav2 UTSW 7 49,058,632 (GRCm39) missense probably benign
R2568:Nav2 UTSW 7 49,247,312 (GRCm39) missense probably damaging 1.00
R2656:Nav2 UTSW 7 49,195,690 (GRCm39) missense probably damaging 1.00
R2964:Nav2 UTSW 7 49,206,780 (GRCm39) missense probably damaging 1.00
R2966:Nav2 UTSW 7 49,206,780 (GRCm39) missense probably damaging 1.00
R3817:Nav2 UTSW 7 49,114,310 (GRCm39) missense probably benign 0.00
R3834:Nav2 UTSW 7 49,195,606 (GRCm39) missense possibly damaging 0.91
R4207:Nav2 UTSW 7 49,246,979 (GRCm39) missense probably damaging 1.00
R4207:Nav2 UTSW 7 49,222,046 (GRCm39) splice site probably null
R4411:Nav2 UTSW 7 49,047,857 (GRCm39) missense probably benign 0.37
R4413:Nav2 UTSW 7 49,047,857 (GRCm39) missense probably benign 0.37
R4440:Nav2 UTSW 7 49,225,011 (GRCm39) splice site probably benign
R4440:Nav2 UTSW 7 49,201,785 (GRCm39) missense possibly damaging 0.86
R4454:Nav2 UTSW 7 49,198,292 (GRCm39) splice site probably null
R4729:Nav2 UTSW 7 49,102,567 (GRCm39) missense probably benign 0.17
R4801:Nav2 UTSW 7 49,195,600 (GRCm39) missense possibly damaging 0.94
R4802:Nav2 UTSW 7 49,195,600 (GRCm39) missense possibly damaging 0.94
R4824:Nav2 UTSW 7 49,058,749 (GRCm39) intron probably benign
R4887:Nav2 UTSW 7 49,198,182 (GRCm39) nonsense probably null
R4908:Nav2 UTSW 7 49,254,258 (GRCm39) missense probably damaging 1.00
R4952:Nav2 UTSW 7 48,954,288 (GRCm39) intron probably benign
R4965:Nav2 UTSW 7 49,202,625 (GRCm39) nonsense probably null
R5169:Nav2 UTSW 7 49,198,231 (GRCm39) nonsense probably null
R5224:Nav2 UTSW 7 49,201,473 (GRCm39) missense probably benign 0.00
R5249:Nav2 UTSW 7 49,185,661 (GRCm39) missense probably damaging 1.00
R5285:Nav2 UTSW 7 49,197,982 (GRCm39) missense probably damaging 1.00
R5314:Nav2 UTSW 7 49,058,440 (GRCm39) small deletion probably benign
R5320:Nav2 UTSW 7 49,141,121 (GRCm39) missense probably benign 0.00
R5377:Nav2 UTSW 7 49,238,908 (GRCm39) missense probably benign 0.02
R5471:Nav2 UTSW 7 49,197,917 (GRCm39) missense probably damaging 1.00
R5754:Nav2 UTSW 7 49,206,794 (GRCm39) missense probably damaging 1.00
R5832:Nav2 UTSW 7 49,197,817 (GRCm39) splice site probably null
R5884:Nav2 UTSW 7 49,246,917 (GRCm39) nonsense probably null
R5921:Nav2 UTSW 7 48,954,324 (GRCm39) intron probably benign
R6180:Nav2 UTSW 7 49,107,915 (GRCm39) missense probably benign 0.39
R6208:Nav2 UTSW 7 49,213,851 (GRCm39) missense probably damaging 0.99
R6373:Nav2 UTSW 7 49,102,923 (GRCm39) missense probably damaging 1.00
R6450:Nav2 UTSW 7 49,244,114 (GRCm39) missense probably damaging 1.00
R6522:Nav2 UTSW 7 49,247,281 (GRCm39) missense probably damaging 1.00
R6626:Nav2 UTSW 7 49,244,100 (GRCm39) missense probably damaging 1.00
R6695:Nav2 UTSW 7 49,114,652 (GRCm39) missense probably benign 0.04
R6705:Nav2 UTSW 7 49,201,664 (GRCm39) missense probably damaging 1.00
R6842:Nav2 UTSW 7 49,107,917 (GRCm39) missense possibly damaging 0.91
R6847:Nav2 UTSW 7 49,141,204 (GRCm39) missense probably benign 0.14
R7287:Nav2 UTSW 7 49,070,076 (GRCm39) missense probably benign 0.01
R7312:Nav2 UTSW 7 49,111,672 (GRCm39) missense possibly damaging 0.55
R7315:Nav2 UTSW 7 49,198,037 (GRCm39) missense possibly damaging 0.61
R7337:Nav2 UTSW 7 49,201,521 (GRCm39) missense possibly damaging 0.56
R7366:Nav2 UTSW 7 49,203,951 (GRCm39) splice site probably null
R7451:Nav2 UTSW 7 49,202,577 (GRCm39) splice site probably null
R7545:Nav2 UTSW 7 49,232,605 (GRCm39) missense probably damaging 1.00
R7706:Nav2 UTSW 7 49,244,067 (GRCm39) missense probably benign 0.35
R7730:Nav2 UTSW 7 49,222,145 (GRCm39) missense probably damaging 1.00
R7812:Nav2 UTSW 7 49,246,921 (GRCm39) missense probably benign 0.13
R8097:Nav2 UTSW 7 49,237,525 (GRCm39) missense probably damaging 1.00
R8110:Nav2 UTSW 7 49,201,698 (GRCm39) nonsense probably null
R8119:Nav2 UTSW 7 49,103,232 (GRCm39) missense probably damaging 0.99
R8298:Nav2 UTSW 7 49,204,009 (GRCm39) critical splice donor site probably null
R8331:Nav2 UTSW 7 49,102,371 (GRCm39) missense probably benign
R8402:Nav2 UTSW 7 49,103,185 (GRCm39) missense probably benign 0.43
R8421:Nav2 UTSW 7 49,102,269 (GRCm39) missense probably benign
R8478:Nav2 UTSW 7 49,111,733 (GRCm39) missense probably damaging 0.99
R8724:Nav2 UTSW 7 49,141,184 (GRCm39) missense possibly damaging 0.82
R8753:Nav2 UTSW 7 49,102,320 (GRCm39) missense probably benign
R8835:Nav2 UTSW 7 49,248,551 (GRCm39) missense possibly damaging 0.83
R8933:Nav2 UTSW 7 49,111,705 (GRCm39) missense probably damaging 1.00
R8957:Nav2 UTSW 7 49,220,964 (GRCm39) missense probably damaging 1.00
R9069:Nav2 UTSW 7 49,208,561 (GRCm39) missense probably damaging 0.99
R9095:Nav2 UTSW 7 49,254,293 (GRCm39) missense probably damaging 1.00
R9223:Nav2 UTSW 7 49,202,599 (GRCm39) missense probably damaging 1.00
R9261:Nav2 UTSW 7 49,246,904 (GRCm39) missense probably damaging 1.00
X0023:Nav2 UTSW 7 49,197,647 (GRCm39) missense possibly damaging 0.47
Z1177:Nav2 UTSW 7 49,243,971 (GRCm39) missense probably benign 0.01
Z1177:Nav2 UTSW 7 49,102,509 (GRCm39) missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- CTATGGTCTGGTGACGACATC -3'
(R):5'- ACTGGCATACTCACACTTGTG -3'

Sequencing Primer
(F):5'- TCTGGTGACGACATCAAGAAATC -3'
(R):5'- GGCATACTCACACTTGTGTACATAC -3'
Posted On 2020-07-28