Incidental Mutation 'R8306:Hmmr'
ID641088
Institutional Source Beutler Lab
Gene Symbol Hmmr
Ensembl Gene ENSMUSG00000020330
Gene Namehyaluronan mediated motility receptor (RHAMM)
SynonymsCD168, Rhamm
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8306 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location40701395-40733422 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40721672 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 206 (S206F)
Ref Sequence ENSEMBL: ENSMUSP00000020579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020579]
Predicted Effect probably damaging
Transcript: ENSMUST00000020579
AA Change: S206F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020579
Gene: ENSMUSG00000020330
AA Change: S206F

DomainStartEndE-ValueType
Pfam:HMMR_N 15 339 1.2e-136 PFAM
low complexity region 375 385 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
Blast:MA 452 578 7e-6 BLAST
Pfam:HMMR_C 636 789 4.3e-71 PFAM
Meta Mutation Damage Score 0.0706 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in cell motility. It is expressed in breast tissue and together with other proteins, it forms a complex with BRCA1 and BRCA2, thus is potentially associated with higher risk of breast cancer. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit impaired fertility and are less susceptible to the formation of aggressive fibromatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 C A 11: 101,411,368 V158F probably damaging Het
Adam1b T C 5: 121,503,149 probably benign Het
Ambn G A 5: 88,459,422 E50K possibly damaging Het
Ash1l A G 3: 88,965,952 D14G probably benign Het
Asphd1 C T 7: 126,948,612 R173H probably damaging Het
Atr A T 9: 95,920,370 T1772S Het
Best3 T C 10: 117,002,610 L191P probably damaging Het
Bola1 A T 3: 96,197,201 S26T probably benign Het
Borcs6 T C 11: 69,059,820 L8P probably benign Het
Brca1 T G 11: 101,525,637 Q557P probably damaging Het
Brca2 G A 5: 150,536,663 E468K possibly damaging Het
Btbd11 T A 10: 85,598,545 C22* probably null Het
Capza2 T A 6: 17,637,132 L4Q probably benign Het
Cc2d2b T A 19: 40,815,784 Y918* probably null Het
Ccdc163 T C 4: 116,710,275 L67P probably damaging Het
Ccdc172 C A 19: 58,536,590 Q160K probably damaging Het
Ccp110 T A 7: 118,722,680 D519E probably benign Het
Cd300ld2 T C 11: 115,013,822 Q73R probably benign Het
Cfap46 T A 7: 139,656,580 D608V Het
Cfap69 T G 5: 5,604,287 Y549S probably benign Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Clu A C 14: 65,979,762 Q348P probably damaging Het
Cnot1 A T 8: 95,747,021 N1153K probably benign Het
Col2a1 T C 15: 97,990,968 probably null Het
Col6a6 A T 9: 105,784,073 I279N probably damaging Het
Dopey1 A G 9: 86,520,206 D1153G possibly damaging Het
Dpyd A G 3: 119,412,173 K888E probably benign Het
Eif2ak4 T C 2: 118,457,175 I1208T possibly damaging Het
Epha1 T C 6: 42,358,788 I972V probably damaging Het
Fam13c C T 10: 70,553,153 T503I probably benign Het
Fbxo43 T A 15: 36,161,867 Q398L probably benign Het
Fbxo44 A G 4: 148,158,632 I57T probably benign Het
Flnc T C 6: 29,449,370 I1422T probably benign Het
Flrt2 T C 12: 95,779,302 L138P probably damaging Het
Frem3 A G 8: 80,612,211 K378E possibly damaging Het
Ganc T A 2: 120,422,079 D128E probably benign Het
Gm19965 T C 1: 116,821,785 S399P Het
H2-Q1 A T 17: 35,321,021 K89* probably null Het
H2-Q2 A T 17: 35,342,325 probably benign Het
Homer2 T A 7: 81,624,266 S125C possibly damaging Het
Hormad2 T C 11: 4,408,714 K231R probably benign Het
Kif17 A C 4: 138,277,909 K262Q probably damaging Het
Kif20a G A 18: 34,628,391 S279N probably benign Het
Lrp12 T C 15: 39,878,054 N441D probably damaging Het
Lta4h G T 10: 93,482,264 L515F possibly damaging Het
Mavs T C 2: 131,246,550 S425P probably benign Het
Mcat A C 15: 83,555,391 D99E probably damaging Het
Nav2 C A 7: 49,546,017 T1047K probably benign Het
Neb T A 2: 52,209,645 Y4731F probably damaging Het
Nectin4 G C 1: 171,383,757 R283P probably null Het
Notch3 G A 17: 32,158,112 T273I probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr1415 T G 1: 92,491,525 I77L possibly damaging Het
Olfr152 A T 2: 87,783,486 *317C probably null Het
Olfr5 T A 7: 6,480,869 I96F possibly damaging Het
Pcdha12 A T 18: 37,022,585 T786S probably benign Het
Pde9a A G 17: 31,473,212 K520E probably benign Het
Piezo2 A C 18: 63,075,730 L1404R probably damaging Het
Rrbp1 T C 2: 143,950,496 S1321G probably benign Het
Rtkn T C 6: 83,151,916 V464A probably damaging Het
Rtn4rl1 T C 11: 75,265,321 F193S probably damaging Het
Samd4 G A 14: 46,884,917 V33I probably damaging Het
Scn5a A G 9: 119,521,291 L839P probably damaging Het
Slc6a17 C A 3: 107,473,669 V507L probably benign Het
Stradb C A 1: 58,991,197 N203K unknown Het
Tenm2 T C 11: 36,069,369 T1044A possibly damaging Het
Tmem245 A C 4: 56,886,037 W860G probably damaging Het
Tpst2 G A 5: 112,307,937 R114H probably damaging Het
Trappc10 C T 10: 78,200,626 D920N possibly damaging Het
Vmn1r59 T A 7: 5,453,967 I265L probably benign Het
Zbtb20 A C 16: 43,618,737 D667A probably damaging Het
Zbtb4 T A 11: 69,777,483 I344N probably damaging Het
Zdbf2 T A 1: 63,304,075 C538S possibly damaging Het
Zmym6 A T 4: 127,122,562 H712L probably damaging Het
Other mutations in Hmmr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01795:Hmmr APN 11 40721734 missense probably benign 0.25
IGL02096:Hmmr APN 11 40707429 missense probably benign 0.02
IGL02224:Hmmr APN 11 40710004 missense unknown
IGL02527:Hmmr APN 11 40708105 missense probably damaging 1.00
IGL02870:Hmmr APN 11 40714075 missense possibly damaging 0.63
IGL03175:Hmmr APN 11 40714809 missense probably benign 0.02
IGL03327:Hmmr APN 11 40715415 missense probably damaging 1.00
R0126:Hmmr UTSW 11 40705954 missense probably damaging 1.00
R0211:Hmmr UTSW 11 40714808 missense probably damaging 0.96
R0533:Hmmr UTSW 11 40709989 missense unknown
R0610:Hmmr UTSW 11 40715902 missense probably damaging 1.00
R0747:Hmmr UTSW 11 40721745 splice site probably benign
R1909:Hmmr UTSW 11 40708098 missense probably damaging 1.00
R2013:Hmmr UTSW 11 40728432 missense possibly damaging 0.85
R4446:Hmmr UTSW 11 40715321 missense probably damaging 1.00
R4897:Hmmr UTSW 11 40728434 missense probably benign 0.00
R4937:Hmmr UTSW 11 40721840 missense possibly damaging 0.90
R5795:Hmmr UTSW 11 40721906 missense probably damaging 1.00
R5873:Hmmr UTSW 11 40707700 missense probably damaging 0.99
R6414:Hmmr UTSW 11 40715867 critical splice donor site probably null
R6962:Hmmr UTSW 11 40707415 missense probably damaging 1.00
R7391:Hmmr UTSW 11 40707786 splice site probably null
R7558:Hmmr UTSW 11 40733329 missense probably damaging 1.00
R7965:Hmmr UTSW 11 40715429 splice site probably null
R8065:Hmmr UTSW 11 40721672 missense probably damaging 1.00
R8066:Hmmr UTSW 11 40721672 missense probably damaging 1.00
R8255:Hmmr UTSW 11 40707435 missense probably damaging 1.00
R8303:Hmmr UTSW 11 40721672 missense probably damaging 1.00
R8304:Hmmr UTSW 11 40721672 missense probably damaging 1.00
R8307:Hmmr UTSW 11 40721672 missense probably damaging 1.00
R8308:Hmmr UTSW 11 40721672 missense probably damaging 1.00
R8387:Hmmr UTSW 11 40721672 missense probably damaging 1.00
R8743:Hmmr UTSW 11 40708031 missense probably damaging 1.00
R8817:Hmmr UTSW 11 40721672 missense probably damaging 1.00
R8820:Hmmr UTSW 11 40721672 missense probably damaging 1.00
R8829:Hmmr UTSW 11 40721672 missense probably damaging 1.00
R8831:Hmmr UTSW 11 40721672 missense probably damaging 1.00
R8838:Hmmr UTSW 11 40714027 missense probably benign 0.00
T0975:Hmmr UTSW 11 40723416 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTATAACGAAACGAGGAGATTC -3'
(R):5'- TGAGAGCTCTAAGCCTGGAATTG -3'

Sequencing Primer
(F):5'- ACGAAACGAGGAGATTCATATATTTG -3'
(R):5'- GCTCTAAGCCTGGAATTGATGAAAC -3'
Posted On2020-07-28