Mutagenetix > Incidental Mutation

Incidental Mutation 'R8306:Hmmr'

641088

Institutional Source

Beutler Lab

Gene Symbol

Hmmr

Ensembl Gene

ENSMUSG00000020330

Gene Name

hyaluronan mediated motility receptor (RHAMM)

Synonyms

CD168, Rhamm

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8306 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

40701395-40733422 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 40721672 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Phenylalanine at position 206 (S206F)

Ref Sequence

ENSEMBL: ENSMUSP00000020579 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020579]

AlphaFold

Q00547

Predicted Effect

probably damaging
Transcript: ENSMUST00000020579
AA Change: S206F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020579
Gene: ENSMUSG00000020330
AA Change: S206F

Domain	Start	End	E-Value	Type
Pfam:HMMR_N	15	339	1.2e-136	PFAM
low complexity region	375	385	N/A	INTRINSIC
low complexity region	430	442	N/A	INTRINSIC
Blast:MA	452	578	7e-6	BLAST
Pfam:HMMR_C	636	789	4.3e-71	PFAM

Meta Mutation Damage Score

0.0706

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in cell motility. It is expressed in breast tissue and together with other proteins, it forms a complex with BRCA1 and BRCA2, thus is potentially associated with higher risk of breast cancer. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit impaired fertility and are less susceptible to the formation of aggressive fibromatosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aarsd1	C	A	11: 101,411,368	V158F	probably damaging	Het
Adam1b	T	C	5: 121,503,149		probably benign	Het
Ambn	G	A	5: 88,459,422	E50K	possibly damaging	Het
Ash1l	A	G	3: 88,965,952	D14G	probably benign	Het
Asphd1	C	T	7: 126,948,612	R173H	probably damaging	Het
Atr	A	T	9: 95,920,370	T1772S		Het
Best3	T	C	10: 117,002,610	L191P	probably damaging	Het
Bola1	A	T	3: 96,197,201	S26T	probably benign	Het
Borcs6	T	C	11: 69,059,820	L8P	probably benign	Het
Brca1	T	G	11: 101,525,637	Q557P	probably damaging	Het
Brca2	G	A	5: 150,536,663	E468K	possibly damaging	Het
Btbd11	T	A	10: 85,598,545	C22*	probably null	Het
Capza2	T	A	6: 17,637,132	L4Q	probably benign	Het
Cc2d2b	T	A	19: 40,815,784	Y918*	probably null	Het
Ccdc163	T	C	4: 116,710,275	L67P	probably damaging	Het
Ccdc172	C	A	19: 58,536,590	Q160K	probably damaging	Het
Ccp110	T	A	7: 118,722,680	D519E	probably benign	Het
Cd300ld2	T	C	11: 115,013,822	Q73R	probably benign	Het
Cfap46	T	A	7: 139,656,580	D608V		Het
Cfap69	T	G	5: 5,604,287	Y549S	probably benign	Het
Cilp	G	A	9: 65,279,004	G794S	probably damaging	Het
Clu	A	C	14: 65,979,762	Q348P	probably damaging	Het
Cnot1	A	T	8: 95,747,021	N1153K	probably benign	Het
Col2a1	T	C	15: 97,990,968		probably null	Het
Col6a6	A	T	9: 105,784,073	I279N	probably damaging	Het
Dopey1	A	G	9: 86,520,206	D1153G	possibly damaging	Het
Dpyd	A	G	3: 119,412,173	K888E	probably benign	Het
Eif2ak4	T	C	2: 118,457,175	I1208T	possibly damaging	Het
Epha1	T	C	6: 42,358,788	I972V	probably damaging	Het
Fam13c	C	T	10: 70,553,153	T503I	probably benign	Het
Fbxo43	T	A	15: 36,161,867	Q398L	probably benign	Het
Fbxo44	A	G	4: 148,158,632	I57T	probably benign	Het
Flnc	T	C	6: 29,449,370	I1422T	probably benign	Het
Flrt2	T	C	12: 95,779,302	L138P	probably damaging	Het
Frem3	A	G	8: 80,612,211	K378E	possibly damaging	Het
Ganc	T	A	2: 120,422,079	D128E	probably benign	Het
Gm19965	T	C	1: 116,821,785	S399P		Het
H2-Q1	A	T	17: 35,321,021	K89*	probably null	Het
H2-Q2	A	T	17: 35,342,325		probably benign	Het
Homer2	T	A	7: 81,624,266	S125C	possibly damaging	Het
Hormad2	T	C	11: 4,408,714	K231R	probably benign	Het
Kif17	A	C	4: 138,277,909	K262Q	probably damaging	Het
Kif20a	G	A	18: 34,628,391	S279N	probably benign	Het
Lrp12	T	C	15: 39,878,054	N441D	probably damaging	Het
Lta4h	G	T	10: 93,482,264	L515F	possibly damaging	Het
Mavs	T	C	2: 131,246,550	S425P	probably benign	Het
Mcat	A	C	15: 83,555,391	D99E	probably damaging	Het
Nav2	C	A	7: 49,546,017	T1047K	probably benign	Het
Neb	T	A	2: 52,209,645	Y4731F	probably damaging	Het
Nectin4	G	C	1: 171,383,757	R283P	probably null	Het
Notch3	G	A	17: 32,158,112	T273I	probably damaging	Het
Olfr1205	G	A	2: 88,831,289	M57I	possibly damaging	Het
Olfr1415	T	G	1: 92,491,525	I77L	possibly damaging	Het
Olfr152	A	T	2: 87,783,486	*317C	probably null	Het
Olfr5	T	A	7: 6,480,869	I96F	possibly damaging	Het
Pcdha12	A	T	18: 37,022,585	T786S	probably benign	Het
Pde9a	A	G	17: 31,473,212	K520E	probably benign	Het
Piezo2	A	C	18: 63,075,730	L1404R	probably damaging	Het
Rrbp1	T	C	2: 143,950,496	S1321G	probably benign	Het
Rtkn	T	C	6: 83,151,916	V464A	probably damaging	Het
Rtn4rl1	T	C	11: 75,265,321	F193S	probably damaging	Het
Samd4	G	A	14: 46,884,917	V33I	probably damaging	Het
Scn5a	A	G	9: 119,521,291	L839P	probably damaging	Het
Slc6a17	C	A	3: 107,473,669	V507L	probably benign	Het
Stradb	C	A	1: 58,991,197	N203K	unknown	Het
Tenm2	T	C	11: 36,069,369	T1044A	possibly damaging	Het
Tmem245	A	C	4: 56,886,037	W860G	probably damaging	Het
Tpst2	G	A	5: 112,307,937	R114H	probably damaging	Het
Trappc10	C	T	10: 78,200,626	D920N	possibly damaging	Het
Vmn1r59	T	A	7: 5,453,967	I265L	probably benign	Het
Zbtb20	A	C	16: 43,618,737	D667A	probably damaging	Het
Zbtb4	T	A	11: 69,777,483	I344N	probably damaging	Het
Zdbf2	T	A	1: 63,304,075	C538S	possibly damaging	Het
Zmym6	A	T	4: 127,122,562	H712L	probably damaging	Het

Other mutations in Hmmr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01795:Hmmr	APN	11	40721734	missense	probably benign	0.25
IGL02096:Hmmr	APN	11	40707429	missense	probably benign	0.02
IGL02224:Hmmr	APN	11	40710004	missense	unknown
IGL02527:Hmmr	APN	11	40708105	missense	probably damaging	1.00
IGL02870:Hmmr	APN	11	40714075	missense	possibly damaging	0.63
IGL03175:Hmmr	APN	11	40714809	missense	probably benign	0.02
IGL03327:Hmmr	APN	11	40715415	missense	probably damaging	1.00
R0126:Hmmr	UTSW	11	40705954	missense	probably damaging	1.00
R0211:Hmmr	UTSW	11	40714808	missense	probably damaging	0.96
R0533:Hmmr	UTSW	11	40709989	missense	unknown
R0610:Hmmr	UTSW	11	40715902	missense	probably damaging	1.00
R0747:Hmmr	UTSW	11	40721745	splice site	probably benign
R1909:Hmmr	UTSW	11	40708098	missense	probably damaging	1.00
R2013:Hmmr	UTSW	11	40728432	missense	possibly damaging	0.85
R4446:Hmmr	UTSW	11	40715321	missense	probably damaging	1.00
R4897:Hmmr	UTSW	11	40728434	missense	probably benign	0.00
R4937:Hmmr	UTSW	11	40721840	missense	possibly damaging	0.90
R5795:Hmmr	UTSW	11	40721906	missense	probably damaging	1.00
R5873:Hmmr	UTSW	11	40707700	missense	probably damaging	0.99
R6414:Hmmr	UTSW	11	40715867	critical splice donor site	probably null
R6962:Hmmr	UTSW	11	40707415	missense	probably damaging	1.00
R7391:Hmmr	UTSW	11	40707786	splice site	probably null
R7558:Hmmr	UTSW	11	40733329	missense	probably damaging	1.00
R7965:Hmmr	UTSW	11	40715429	splice site	probably null
R8065:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8066:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8255:Hmmr	UTSW	11	40707435	missense	probably damaging	1.00
R8303:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8304:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8307:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8308:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8387:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8743:Hmmr	UTSW	11	40708031	missense	probably damaging	1.00
R8817:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8820:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8829:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8831:Hmmr	UTSW	11	40721672	missense	probably damaging	1.00
R8838:Hmmr	UTSW	11	40714027	missense	probably benign	0.00
R9312:Hmmr	UTSW	11	40723489	missense	possibly damaging	0.77
R9453:Hmmr	UTSW	11	40721828	critical splice donor site	probably null
R9468:Hmmr	UTSW	11	40723487	nonsense	probably null
R9601:Hmmr	UTSW	11	40707383	nonsense	probably null
T0975:Hmmr	UTSW	11	40723416	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGTATAACGAAACGAGGAGATTC -3'
(R):5'- TGAGAGCTCTAAGCCTGGAATTG -3'

Sequencing Primer
(F):5'- ACGAAACGAGGAGATTCATATATTTG -3'
(R):5'- GCTCTAAGCCTGGAATTGATGAAAC -3'

Posted On

2020-07-28