Incidental Mutation 'R0098:Stat5a'
ID64111
Institutional Source Beutler Lab
Gene Symbol Stat5a
Ensembl Gene ENSMUSG00000004043
Gene Namesignal transducer and activator of transcription 5A
SynonymsSTAT5
MMRRC Submission 038384-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0098 (G1)
Quality Score140
Status Validated
Chromosome11
Chromosomal Location100859351-100885169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100875626 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 378 (Q378L)
Ref Sequence ENSEMBL: ENSMUSP00000102980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004145] [ENSMUST00000107356] [ENSMUST00000107357]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004145
AA Change: Q378L

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000004145
Gene: ENSMUSG00000004043
AA Change: Q378L

DomainStartEndE-ValueType
STAT_int 2 126 4.42e-62 SMART
Pfam:STAT_alpha 138 330 6.9e-58 PFAM
Pfam:STAT_bind 332 583 2.4e-101 PFAM
SH2 587 688 7.64e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107356
AA Change: Q378L

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102979
Gene: ENSMUSG00000004043
AA Change: Q378L

DomainStartEndE-ValueType
STAT_int 2 126 4.42e-62 SMART
Pfam:STAT_alpha 138 330 6.9e-58 PFAM
Pfam:STAT_bind 332 583 2.4e-101 PFAM
SH2 587 688 7.64e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107357
AA Change: Q378L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102980
Gene: ENSMUSG00000004043
AA Change: Q378L

DomainStartEndE-ValueType
STAT_int 2 126 4.42e-62 SMART
Pfam:STAT_alpha 141 330 4.5e-57 PFAM
Pfam:STAT_bind 332 582 1e-104 PFAM
SH2 587 688 1.55e-6 SMART
low complexity region 713 729 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154087
Meta Mutation Damage Score 0.5129 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated by, and mediates the responses of many cell ligands, such as IL2, IL3, IL7 GM-CSF, erythropoietin, thrombopoietin, and different growth hormones. Activation of this protein in myeloma and lymphoma associated with a TEL/JAK2 gene fusion is independent of cell stimulus and has been shown to be essential for tumorigenesis. The mouse counterpart of this gene is found to induce the expression of BCL2L1/BCL-X(L), which suggests the antiapoptotic function of this gene in cells. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene are reduced in size and display abnormalities in both mammary gland structure and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,073,540 I97T probably damaging Het
Acpp C T 9: 104,319,945 probably null Het
Adam32 T A 8: 24,914,389 Y200F possibly damaging Het
Alpk2 A G 18: 65,349,911 L342S probably damaging Het
Arfgef3 A G 10: 18,589,642 V2151A probably damaging Het
Atm T C 9: 53,518,569 D389G probably benign Het
Atp10b A T 11: 43,189,604 S236C probably benign Het
B3gat1 C T 9: 26,756,941 R276C probably damaging Het
Cndp1 T A 18: 84,628,824 E246D probably damaging Het
Crebbp A G 16: 4,091,928 L1078P probably damaging Het
Cyp20a1 G T 1: 60,387,254 E452* probably null Het
Emb T C 13: 117,267,498 V262A probably damaging Het
Ephb1 C T 9: 102,041,140 R390H probably damaging Het
Faf1 T C 4: 109,935,499 L556S probably damaging Het
Fbf1 A T 11: 116,148,119 probably null Het
Gid8 T A 2: 180,714,735 I55N possibly damaging Het
Gm8773 T A 5: 5,575,355 L17Q possibly damaging Het
Hexa T C 9: 59,558,100 Y213H probably damaging Het
Kalrn A T 16: 33,975,619 I1262K possibly damaging Het
Lrp1 C T 10: 127,552,738 V3281I probably benign Het
Lrp2 T C 2: 69,475,412 D2935G probably damaging Het
Lypd6 T A 2: 50,190,780 V160E probably benign Het
Muc19 C T 15: 91,892,907 noncoding transcript Het
Mybpc1 T C 10: 88,529,564 D899G probably benign Het
Myo18a A G 11: 77,845,765 E1564G probably damaging Het
Nrxn3 A G 12: 89,260,201 D202G probably damaging Het
Palld C A 8: 61,525,086 G890V probably damaging Het
Pcx C A 19: 4,601,747 probably benign Het
Plcg1 T C 2: 160,732,000 W62R probably damaging Het
Ppa2 C T 3: 133,370,473 probably benign Het
Ppp1r18 A G 17: 35,867,996 I254M probably benign Het
Prune2 A G 19: 17,123,903 E2257G possibly damaging Het
Rd3 A G 1: 191,985,300 M244V probably benign Het
Rfx5 T A 3: 94,958,368 V326E probably damaging Het
Rgs3 G C 4: 62,625,906 R305P probably damaging Het
Rpp40 A G 13: 35,898,987 Y173H probably benign Het
Ryr3 T C 2: 112,901,031 N645D probably damaging Het
Sema3e T C 5: 14,252,432 V657A possibly damaging Het
Serpina3n T A 12: 104,413,518 V390E probably damaging Het
Shank1 A G 7: 44,313,285 Y141C unknown Het
Stat2 T A 10: 128,283,262 H428Q probably damaging Het
Tfrc G T 16: 32,623,426 V490F probably damaging Het
Tnnt1 T C 7: 4,509,045 N155S probably damaging Het
Topaz1 T C 9: 122,790,123 Y1262H possibly damaging Het
Ubxn8 T C 8: 33,635,365 probably benign Het
Unk A G 11: 116,050,169 Y252C probably damaging Het
Vmn2r66 A C 7: 85,005,757 M448R probably damaging Het
Zfp386 T A 12: 116,059,214 L184* probably null Het
Zfp985 T C 4: 147,577,109 S4P probably damaging Het
Other mutations in Stat5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Stat5a APN 11 100881072 missense probably damaging 1.00
IGL02021:Stat5a APN 11 100883889 missense probably damaging 1.00
IGL02032:Stat5a APN 11 100861828 missense probably damaging 0.99
IGL03108:Stat5a APN 11 100863139 nonsense probably null
IGL03160:Stat5a APN 11 100861845 missense possibly damaging 0.71
hohum UTSW 11 100874129 missense probably damaging 1.00
R8176_stat5a_357 UTSW 11 100876863 missense probably damaging 1.00
yawn UTSW 11 100879693 missense possibly damaging 0.50
R0362:Stat5a UTSW 11 100882083 missense probably benign 0.01
R0452:Stat5a UTSW 11 100863135 missense probably benign 0.20
R0520:Stat5a UTSW 11 100861426 missense probably damaging 0.98
R0815:Stat5a UTSW 11 100875082 splice site probably null
R1081:Stat5a UTSW 11 100881060 missense probably damaging 1.00
R1752:Stat5a UTSW 11 100884058 makesense probably null
R1774:Stat5a UTSW 11 100879286 missense probably damaging 1.00
R1868:Stat5a UTSW 11 100874129 missense probably damaging 1.00
R2152:Stat5a UTSW 11 100874090 missense probably benign 0.38
R2900:Stat5a UTSW 11 100874131 missense probably benign 0.18
R4023:Stat5a UTSW 11 100874926 nonsense probably null
R4791:Stat5a UTSW 11 100865463 missense probably damaging 1.00
R5396:Stat5a UTSW 11 100880583 missense probably damaging 1.00
R5641:Stat5a UTSW 11 100876808 missense probably benign 0.01
R5723:Stat5a UTSW 11 100882074 missense probably benign 0.00
R5896:Stat5a UTSW 11 100877057 missense possibly damaging 0.94
R6026:Stat5a UTSW 11 100880316 missense probably damaging 1.00
R7052:Stat5a UTSW 11 100879285 missense probably damaging 1.00
R7075:Stat5a UTSW 11 100879693 missense possibly damaging 0.50
R7568:Stat5a UTSW 11 100875024 missense possibly damaging 0.74
R7771:Stat5a UTSW 11 100863219 missense probably benign 0.34
R7801:Stat5a UTSW 11 100880317 missense probably damaging 1.00
R7814:Stat5a UTSW 11 100875027 missense probably damaging 1.00
R7856:Stat5a UTSW 11 100883902 missense unknown
R8176:Stat5a UTSW 11 100876863 missense probably damaging 1.00
R8234:Stat5a UTSW 11 100879303 missense possibly damaging 0.59
R8680:Stat5a UTSW 11 100883888 missense unknown
R8923:Stat5a UTSW 11 100880482 missense
Predicted Primers PCR Primer
(F):5'- CGCAGCACGTTCATCATCGAGAAG -3'
(R):5'- CCCACTGCTCAGCATACATGATAGG -3'

Sequencing Primer
(F):5'- GTTCATCATCGAGAAGCAGCC -3'
(R):5'- GTACATATCAGCACTGGCTGC -3'
Posted On2013-08-06