Incidental Mutation 'R8307:Rab11fip4'
ID641149
Institutional Source Beutler Lab
Gene Symbol Rab11fip4
Ensembl Gene ENSMUSG00000017639
Gene NameRAB11 family interacting protein 4 (class II)
SynonymsA730072L08Rik, RAB11-FIP4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8307 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location79591212-79698023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79690774 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 532 (N532Y)
Ref Sequence ENSEMBL: ENSMUSP00000017783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017783]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017783
AA Change: N532Y

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000017783
Gene: ENSMUSG00000017639
AA Change: N532Y

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
SCOP:d1mr8a_ 17 90 2e-4 SMART
Blast:EFh 54 81 2e-10 BLAST
low complexity region 247 252 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
Blast:BRLZ 507 574 7e-24 BLAST
Pfam:RBD-FIP 594 634 1.4e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with RAB11 and is thought to be involved in bringing recycling endosome membranes to the cleavage furrow in late cytokinesis. Hypoxic conditions can lead to an upregulation of the encoded protein and enhance the metastatic potential of hepatocellular carcinoma. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik C A 4: 147,941,380 T119K probably benign Het
Abca13 T A 11: 9,277,922 L655* probably null Het
Aifm2 A G 10: 61,726,392 Y69C probably damaging Het
Atp2c1 C T 9: 105,442,831 V448I probably benign Het
Barx2 A G 9: 31,859,011 S74P probably damaging Het
Bod1l T C 5: 41,821,155 K939E probably damaging Het
Cdh12 C A 15: 21,358,863 F124L probably benign Het
Cdh12 T A 15: 21,358,864 Y125N probably damaging Het
Cdx2 A G 5: 147,306,667 Y106H possibly damaging Het
Chmp1a C T 8: 123,206,241 G158S probably damaging Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Cntnap1 A T 11: 101,188,876 Y1277F possibly damaging Het
Csde1 A G 3: 103,039,073 probably benign Het
Dennd4c A C 4: 86,825,872 D1317A probably benign Het
Dgcr2 C T 16: 17,858,378 G176D probably benign Het
Dock2 A T 11: 34,310,362 M993K possibly damaging Het
Dpy19l1 G A 9: 24,503,001 P44S probably benign Het
Dsg2 C T 18: 20,575,064 P74L probably benign Het
Epg5 T A 18: 78,022,679 F2078Y probably damaging Het
Fam208a G T 14: 27,471,665 A941S probably damaging Het
Fancl A G 11: 26,399,642 probably benign Het
Fbn1 C A 2: 125,505,482 R41L possibly damaging Het
Gemin5 G A 11: 58,151,594 T467M probably damaging Het
Gm11744 A T 11: 116,659,373 T76S possibly damaging Het
Gm6205 T G 5: 94,683,557 L141R probably damaging Het
Hexb T C 13: 97,194,199 Q102R probably benign Het
Hmcn2 A G 2: 31,396,115 D2093G probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Igkv1-131 A G 6: 67,766,067 Y111H probably damaging Het
Il6st G T 13: 112,487,747 G177V probably benign Het
Kank4 G A 4: 98,778,678 Q511* probably null Het
Krt90 A G 15: 101,559,199 L248P probably damaging Het
Krtap5-2 A G 7: 142,174,849 C187R unknown Het
Lonp1 C A 17: 56,626,573 A101S probably benign Het
Nckap5l A G 15: 99,423,177 C1241R probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr339 A G 2: 36,422,321 T308A probably benign Het
Olfr772 T C 10: 129,174,232 D263G probably benign Het
Pcdh15 T A 10: 74,506,475 C1131* probably null Het
Pcdhgc3 A G 18: 37,807,794 D416G probably damaging Het
Pikfyve T C 1: 65,245,735 M786T possibly damaging Het
Pink1 A T 4: 138,317,962 M297K probably benign Het
Pln T C 10: 53,343,879 Y6H unknown Het
Ppp2r2c A G 5: 36,947,086 D270G probably damaging Het
Pxylp1 A G 9: 96,839,084 probably null Het
Ralgapa1 C A 12: 55,741,523 V592L probably damaging Het
Robo2 T C 16: 73,956,610 D793G probably damaging Het
Sec14l1 G A 11: 117,143,416 probably null Het
Srcap T A 7: 127,525,369 V237E probably damaging Het
Srl A G 16: 4,497,145 I211T probably benign Het
Tet3 A G 6: 83,379,927 V883A probably damaging Het
Trim46 A G 3: 89,243,916 Y113H probably benign Het
Trim58 G A 11: 58,647,083 A267T probably benign Het
Tsks G A 7: 44,957,662 G140S Het
Vmn2r110 C A 17: 20,583,057 V419L probably benign Het
Vmn2r66 A G 7: 85,007,062 F249L probably benign Het
Vps8 A C 16: 21,495,902 D584A probably benign Het
Zfp605 T A 5: 110,128,197 C394S probably damaging Het
Zscan4e A G 7: 11,307,132 I271T probably benign Het
Other mutations in Rab11fip4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Rab11fip4 APN 11 79691879 missense possibly damaging 0.70
IGL01867:Rab11fip4 APN 11 79683390 missense probably benign 0.04
R0013:Rab11fip4 UTSW 11 79689653 missense probably benign 0.27
R0277:Rab11fip4 UTSW 11 79686629 missense possibly damaging 0.82
R0737:Rab11fip4 UTSW 11 79683502 missense probably benign
R4975:Rab11fip4 UTSW 11 79619671 missense probably damaging 1.00
R5382:Rab11fip4 UTSW 11 79690715 missense possibly damaging 0.94
R5982:Rab11fip4 UTSW 11 79690775 missense probably benign
R6086:Rab11fip4 UTSW 11 79683480 missense probably damaging 1.00
R6267:Rab11fip4 UTSW 11 79690829 critical splice donor site probably null
R6296:Rab11fip4 UTSW 11 79690829 critical splice donor site probably null
R7468:Rab11fip4 UTSW 11 79689652 missense probably benign 0.02
R8156:Rab11fip4 UTSW 11 79686589 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCTTTACAAGCGCATGATGG -3'
(R):5'- TTGGCGATCAGGTAGCTGAG -3'

Sequencing Primer
(F):5'- CCTTTACAAGCGCATGATGGACAAG -3'
(R):5'- CGATCAGGTAGCTGAGAAGAGAC -3'
Posted On2020-07-28