Mutagenetix > Incidental Mutations

Incidental Mutation 'R8307:Ralgapa1'

641153

Institutional Source

Beutler Lab

Gene Symbol

Ralgapa1

Ensembl Gene

ENSMUSG00000021027

Gene Name

Ral GTPase activating protein, alpha subunit 1

Synonyms

Garnl1, 4930400K19Rik, 2310003F20Rik, Tulip1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.842) question?

Stock #

R8307 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

55602896-55821167 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 55741523 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 592 (V592L)

Ref Sequence

ENSEMBL: ENSMUSP00000082503 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085385] [ENSMUST00000110687]

Predicted Effect

probably damaging
Transcript: ENSMUST00000085385
AA Change: V592L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027
AA Change: V592L

Domain	Start	End	E-Value	Type
low complexity region	644	651	N/A	INTRINSIC
low complexity region	676	690	N/A	INTRINSIC
low complexity region	692	704	N/A	INTRINSIC
low complexity region	894	915	N/A	INTRINSIC
low complexity region	1386	1395	N/A	INTRINSIC
low complexity region	1784	1798	N/A	INTRINSIC
Pfam:Rap_GAP	1824	2003	7.4e-66	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110687
AA Change: V592L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027
AA Change: V592L

Domain	Start	End	E-Value	Type
low complexity region	644	651	N/A	INTRINSIC
low complexity region	676	690	N/A	INTRINSIC
low complexity region	692	704	N/A	INTRINSIC
low complexity region	894	915	N/A	INTRINSIC
low complexity region	1386	1395	N/A	INTRINSIC
low complexity region	1784	1798	N/A	INTRINSIC
Pfam:Rap_GAP	1824	2001	1.9e-48	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major subunit of the RAL-GTPase activating protein. A similar protein in mouse binds E12, a transcriptional regulator of immunoglobulin genes. The mouse protein also functions in skeletal muscle by binding to the regulatory 14-3-3 proteins upon stimulation with insulin or muscle contraction. A pseudogene of this gene has been identified on chromosome 9. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510039O18Rik	C	A	4: 147,941,380	T119K	probably benign	Het
Abca13	T	A	11: 9,277,922	L655*	probably null	Het
Aifm2	A	G	10: 61,726,392	Y69C	probably damaging	Het
Atp2c1	C	T	9: 105,442,831	V448I	probably benign	Het
Barx2	A	G	9: 31,859,011	S74P	probably damaging	Het
Bod1l	T	C	5: 41,821,155	K939E	probably damaging	Het
Cdh12	T	A	15: 21,358,864	Y125N	probably damaging	Het
Cdh12	C	A	15: 21,358,863	F124L	probably benign	Het
Cdx2	A	G	5: 147,306,667	Y106H	possibly damaging	Het
Chmp1a	C	T	8: 123,206,241	G158S	probably damaging	Het
Cilp	G	A	9: 65,279,004	G794S	probably damaging	Het
Cntnap1	A	T	11: 101,188,876	Y1277F	possibly damaging	Het
Csde1	A	G	3: 103,039,073		probably benign	Het
Dennd4c	A	C	4: 86,825,872	D1317A	probably benign	Het
Dgcr2	C	T	16: 17,858,378	G176D	probably benign	Het
Dock2	A	T	11: 34,310,362	M993K	possibly damaging	Het
Dpy19l1	G	A	9: 24,503,001	P44S	probably benign	Het
Dsg2	C	T	18: 20,575,064	P74L	probably benign	Het
Epg5	T	A	18: 78,022,679	F2078Y	probably damaging	Het
Fam208a	G	T	14: 27,471,665	A941S	probably damaging	Het
Fancl	A	G	11: 26,399,642		probably benign	Het
Fbn1	C	A	2: 125,505,482	R41L	possibly damaging	Het
Gemin5	G	A	11: 58,151,594	T467M	probably damaging	Het
Gm11744	A	T	11: 116,659,373	T76S	possibly damaging	Het
Gm6205	T	G	5: 94,683,557	L141R	probably damaging	Het
Hexb	T	C	13: 97,194,199	Q102R	probably benign	Het
Hmcn2	A	G	2: 31,396,115	D2093G	probably damaging	Het
Hmmr	G	A	11: 40,721,672	S206F	probably damaging	Het
Igkv1-131	A	G	6: 67,766,067	Y111H	probably damaging	Het
Il6st	G	T	13: 112,487,747	G177V	probably benign	Het
Kank4	G	A	4: 98,778,678	Q511*	probably null	Het
Krt90	A	G	15: 101,559,199	L248P	probably damaging	Het
Krtap5-2	A	G	7: 142,174,849	C187R	unknown	Het
Lonp1	C	A	17: 56,626,573	A101S	probably benign	Het
Nckap5l	A	G	15: 99,423,177	C1241R	probably damaging	Het
Olfr1205	G	A	2: 88,831,289	M57I	possibly damaging	Het
Olfr339	A	G	2: 36,422,321	T308A	probably benign	Het
Olfr772	T	C	10: 129,174,232	D263G	probably benign	Het
Pcdh15	T	A	10: 74,506,475	C1131*	probably null	Het
Pcdhgc3	A	G	18: 37,807,794	D416G	probably damaging	Het
Pikfyve	T	C	1: 65,245,735	M786T	possibly damaging	Het
Pink1	A	T	4: 138,317,962	M297K	probably benign	Het
Pln	T	C	10: 53,343,879	Y6H	unknown	Het
Ppp2r2c	A	G	5: 36,947,086	D270G	probably damaging	Het
Pxylp1	A	G	9: 96,839,084		probably null	Het
Rab11fip4	A	T	11: 79,690,774	N532Y	possibly damaging	Het
Robo2	T	C	16: 73,956,610	D793G	probably damaging	Het
Sec14l1	G	A	11: 117,143,416		probably null	Het
Srcap	T	A	7: 127,525,369	V237E	probably damaging	Het
Srl	A	G	16: 4,497,145	I211T	probably benign	Het
Tet3	A	G	6: 83,379,927	V883A	probably damaging	Het
Trim46	A	G	3: 89,243,916	Y113H	probably benign	Het
Trim58	G	A	11: 58,647,083	A267T	probably benign	Het
Tsks	G	A	7: 44,957,662	G140S		Het
Vmn2r110	C	A	17: 20,583,057	V419L	probably benign	Het
Vmn2r66	A	G	7: 85,007,062	F249L	probably benign	Het
Vps8	A	C	16: 21,495,902	D584A	probably benign	Het
Zfp605	T	A	5: 110,128,197	C394S	probably damaging	Het
Zscan4e	A	G	7: 11,307,132	I271T	probably benign	Het

Other mutations in Ralgapa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Ralgapa1	APN	12	55722773	missense	probably damaging	0.98
IGL00494:Ralgapa1	APN	12	55747185	missense	probably damaging	1.00
IGL00731:Ralgapa1	APN	12	55702452	missense	possibly damaging	0.94
IGL00851:Ralgapa1	APN	12	55709575	missense	possibly damaging	0.93
IGL01133:Ralgapa1	APN	12	55642348	missense	probably damaging	1.00
IGL01133:Ralgapa1	APN	12	55642359	missense	probably damaging	0.99
IGL01354:Ralgapa1	APN	12	55777316	missense	possibly damaging	0.68
IGL01514:Ralgapa1	APN	12	55719657	missense	probably damaging	0.97
IGL02033:Ralgapa1	APN	12	55642477	missense	possibly damaging	0.69
IGL02064:Ralgapa1	APN	12	55708077	missense	probably damaging	1.00
IGL02556:Ralgapa1	APN	12	55642449	missense	possibly damaging	0.80
IGL02605:Ralgapa1	APN	12	55712665	missense	possibly damaging	0.90
IGL02657:Ralgapa1	APN	12	55673507	missense	probably damaging	1.00
IGL02676:Ralgapa1	APN	12	55676417	missense	probably damaging	1.00
IGL02894:Ralgapa1	APN	12	55717069	missense	possibly damaging	0.79
IGL02944:Ralgapa1	APN	12	55757951	missense	probably benign	0.01
Anhydrous	UTSW	12	55795778	critical splice acceptor site	probably null
Aqueous	UTSW	12	55698854	missense	probably damaging	1.00
bantam	UTSW	12	55722773	critical splice donor site	probably null
Deliquescent	UTSW	12	55782900	splice site	probably benign
wickedwarlock	UTSW	12	55777292	missense	probably null	0.99
F5770:Ralgapa1	UTSW	12	55795653	splice site	probably benign
IGL03046:Ralgapa1	UTSW	12	55695157	missense	probably damaging	1.00
R0011:Ralgapa1	UTSW	12	55786263	missense	probably damaging	0.99
R0096:Ralgapa1	UTSW	12	55739505	missense	probably damaging	1.00
R0277:Ralgapa1	UTSW	12	55677238	missense	probably damaging	0.99
R0323:Ralgapa1	UTSW	12	55677238	missense	probably damaging	0.99
R0333:Ralgapa1	UTSW	12	55782900	splice site	probably benign
R0361:Ralgapa1	UTSW	12	55676569	missense	possibly damaging	0.93
R0385:Ralgapa1	UTSW	12	55677038	missense	probably damaging	1.00
R0386:Ralgapa1	UTSW	12	55708067	missense	probably benign	0.03
R0498:Ralgapa1	UTSW	12	55689791	missense	possibly damaging	0.66
R0552:Ralgapa1	UTSW	12	55676765	missense	probably benign	0.27
R0564:Ralgapa1	UTSW	12	55782885	missense	possibly damaging	0.84
R0611:Ralgapa1	UTSW	12	55795698	missense	probably damaging	0.99
R0730:Ralgapa1	UTSW	12	55665663	missense	probably damaging	1.00
R0741:Ralgapa1	UTSW	12	55676581	missense	probably damaging	0.99
R0815:Ralgapa1	UTSW	12	55762681	nonsense	probably null
R0815:Ralgapa1	UTSW	12	55782777	splice site	probably benign
R0863:Ralgapa1	UTSW	12	55762681	nonsense	probably null
R0863:Ralgapa1	UTSW	12	55782777	splice site	probably benign
R1068:Ralgapa1	UTSW	12	55790310	critical splice donor site	probably null
R1147:Ralgapa1	UTSW	12	55702480	missense	probably damaging	1.00
R1147:Ralgapa1	UTSW	12	55702480	missense	probably damaging	1.00
R1256:Ralgapa1	UTSW	12	55762661	missense	possibly damaging	0.94
R1343:Ralgapa1	UTSW	12	55707978	missense	probably damaging	1.00
R1378:Ralgapa1	UTSW	12	55676926	missense	probably damaging	1.00
R1474:Ralgapa1	UTSW	12	55741480	missense	probably benign	0.09
R1494:Ralgapa1	UTSW	12	55684524	missense	probably damaging	0.99
R1593:Ralgapa1	UTSW	12	55770703	missense	probably damaging	1.00
R1607:Ralgapa1	UTSW	12	55741536	missense	probably damaging	1.00
R1681:Ralgapa1	UTSW	12	55762603	missense	probably benign	0.35
R1689:Ralgapa1	UTSW	12	55676767	missense	possibly damaging	0.79
R1714:Ralgapa1	UTSW	12	55642389	missense	probably damaging	1.00
R1832:Ralgapa1	UTSW	12	55757967	missense	probably benign	0.03
R1870:Ralgapa1	UTSW	12	55677032	missense	possibly damaging	0.66
R2040:Ralgapa1	UTSW	12	55786322	missense	probably damaging	1.00
R2043:Ralgapa1	UTSW	12	55677026	missense	probably damaging	0.99
R2046:Ralgapa1	UTSW	12	55695160	missense	probably damaging	1.00
R2109:Ralgapa1	UTSW	12	55776188	missense	possibly damaging	0.90
R2114:Ralgapa1	UTSW	12	55786349	critical splice acceptor site	probably null
R2115:Ralgapa1	UTSW	12	55786349	critical splice acceptor site	probably null
R2202:Ralgapa1	UTSW	12	55612800	splice site	probably null
R2203:Ralgapa1	UTSW	12	55612800	splice site	probably null
R2233:Ralgapa1	UTSW	12	55717071	missense	probably benign	0.13
R2235:Ralgapa1	UTSW	12	55717071	missense	probably benign	0.13
R2341:Ralgapa1	UTSW	12	55677124	missense	possibly damaging	0.66
R2507:Ralgapa1	UTSW	12	55718201	missense	probably damaging	1.00
R2508:Ralgapa1	UTSW	12	55718201	missense	probably damaging	1.00
R2972:Ralgapa1	UTSW	12	55820755	missense	possibly damaging	0.61
R3160:Ralgapa1	UTSW	12	55709586	missense	probably damaging	1.00
R3162:Ralgapa1	UTSW	12	55709586	missense	probably damaging	1.00
R3401:Ralgapa1	UTSW	12	55659137	missense	possibly damaging	0.66
R3416:Ralgapa1	UTSW	12	55770613	splice site	probably benign
R3499:Ralgapa1	UTSW	12	55695143	splice site	probably benign
R3799:Ralgapa1	UTSW	12	55659130	missense	probably damaging	1.00
R3948:Ralgapa1	UTSW	12	55698767	missense	probably damaging	1.00
R4039:Ralgapa1	UTSW	12	55795701	missense	probably damaging	0.99
R4120:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4165:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4166:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4212:Ralgapa1	UTSW	12	55739330	critical splice donor site	probably null
R4232:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4233:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4234:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4235:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4399:Ralgapa1	UTSW	12	55795778	critical splice acceptor site	probably null
R4698:Ralgapa1	UTSW	12	55677276	splice site	probably null
R4715:Ralgapa1	UTSW	12	55693458	missense	probably damaging	1.00
R4755:Ralgapa1	UTSW	12	55712748	missense	probably damaging	1.00
R4810:Ralgapa1	UTSW	12	55794993	critical splice donor site	probably null
R4827:Ralgapa1	UTSW	12	55676437	missense	probably damaging	1.00
R4849:Ralgapa1	UTSW	12	55698803	missense	probably damaging	0.99
R4934:Ralgapa1	UTSW	12	55762574	missense	possibly damaging	0.94
R5006:Ralgapa1	UTSW	12	55718114	missense	probably benign	0.02
R5114:Ralgapa1	UTSW	12	55612723	missense	possibly damaging	0.84
R5140:Ralgapa1	UTSW	12	55776152	missense	probably damaging	1.00
R5140:Ralgapa1	UTSW	12	55665674	missense	probably damaging	1.00
R5168:Ralgapa1	UTSW	12	55758032	missense	probably benign	0.05
R5407:Ralgapa1	UTSW	12	55676797	missense	possibly damaging	0.93
R5441:Ralgapa1	UTSW	12	55719623	missense	probably damaging	1.00
R5473:Ralgapa1	UTSW	12	55676710	missense	probably benign	0.41
R5624:Ralgapa1	UTSW	12	55612738	missense	probably damaging	1.00
R5766:Ralgapa1	UTSW	12	55820766	start codon destroyed	probably null	0.99
R5826:Ralgapa1	UTSW	12	55677113	missense	probably damaging	1.00
R5950:Ralgapa1	UTSW	12	55738265	missense	possibly damaging	0.58
R5980:Ralgapa1	UTSW	12	55770616	splice site	probably null
R6019:Ralgapa1	UTSW	12	55684042	missense	possibly damaging	0.92
R6065:Ralgapa1	UTSW	12	55757924	critical splice donor site	probably null
R6326:Ralgapa1	UTSW	12	55747146	missense	probably damaging	1.00
R6355:Ralgapa1	UTSW	12	55698854	missense	probably damaging	1.00
R6408:Ralgapa1	UTSW	12	55683910	nonsense	probably null
R6448:Ralgapa1	UTSW	12	55719661	missense	probably benign	0.14
R6453:Ralgapa1	UTSW	12	55738319	missense	probably damaging	1.00
R6590:Ralgapa1	UTSW	12	55722773	critical splice donor site	probably null
R6690:Ralgapa1	UTSW	12	55722773	critical splice donor site	probably null
R6738:Ralgapa1	UTSW	12	55762727	missense	probably damaging	1.00
R6836:Ralgapa1	UTSW	12	55604273	splice site	probably null
R6936:Ralgapa1	UTSW	12	55786212	missense	probably damaging	0.99
R6945:Ralgapa1	UTSW	12	55776191	missense	possibly damaging	0.64
R7028:Ralgapa1	UTSW	12	55758059	missense	probably damaging	1.00
R7075:Ralgapa1	UTSW	12	55820723	missense	possibly damaging	0.66
R7076:Ralgapa1	UTSW	12	55721576	missense	possibly damaging	0.82
R7098:Ralgapa1	UTSW	12	55790310	critical splice donor site	probably null
R7231:Ralgapa1	UTSW	12	55604191	missense	probably damaging	1.00
R7254:Ralgapa1	UTSW	12	55695193	missense	probably damaging	1.00
R7326:Ralgapa1	UTSW	12	55709004	missense	probably damaging	1.00
R7485:Ralgapa1	UTSW	12	55712672	missense	probably damaging	1.00
R7580:Ralgapa1	UTSW	12	55718228	missense	probably benign	0.00
R7677:Ralgapa1	UTSW	12	55659143	missense	probably damaging	0.96
R7702:Ralgapa1	UTSW	12	55709555	missense	probably damaging	1.00
R7702:Ralgapa1	UTSW	12	55709556	missense	probably damaging	1.00
R7707:Ralgapa1	UTSW	12	55777292	missense	probably null	0.99
R7723:Ralgapa1	UTSW	12	55741513	missense	probably benign
R7763:Ralgapa1	UTSW	12	55757955	missense	probably benign	0.28
R7791:Ralgapa1	UTSW	12	55741519	missense	probably damaging	0.97
R7812:Ralgapa1	UTSW	12	55719628	missense	possibly damaging	0.67
R7868:Ralgapa1	UTSW	12	55612638	missense	probably benign	0.00
R7895:Ralgapa1	UTSW	12	55747149	missense	probably benign	0.44
R7896:Ralgapa1	UTSW	12	55697878	missense	probably benign	0.01
R8004:Ralgapa1	UTSW	12	55702457	missense	probably damaging	0.99
R8094:Ralgapa1	UTSW	12	55782846	missense	probably damaging	0.99
R8213:Ralgapa1	UTSW	12	55722914	missense	probably damaging	0.99
R8423:Ralgapa1	UTSW	12	55659062	missense	probably damaging	0.99
R8462:Ralgapa1	UTSW	12	55676518	missense	possibly damaging	0.90
R8469:Ralgapa1	UTSW	12	55739413	missense	probably damaging	1.00
R8675:Ralgapa1	UTSW	12	55738217	missense	possibly damaging	0.93
R8802:Ralgapa1	UTSW	12	55738316	missense	probably damaging	0.99
Z1176:Ralgapa1	UTSW	12	55709080	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGAACTGGCTTGTAACTTAAAGC -3'
(R):5'- GGTATTGATTGTGCTTAGAAACTTCAG -3'

Sequencing Primer
(F):5'- GGCTTGTAACTTAAAGCATTTTCTCC -3'
(R):5'- CGAGTTATCCCAACAATAATGT -3'

Posted On

2020-07-28