Incidental Mutation 'R8307:Fam208a'
ID641156
Institutional Source Beutler Lab
Gene Symbol Fam208a
Ensembl Gene ENSMUSG00000040651
Gene Namefamily with sequence similarity 208, member A
SynonymsD14Abb1e, 4933409E02Rik
Accession Numbers

Ensembl: ENSMUST00000059031; MGI: 1921694

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8307 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location27428834-27483555 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 27471665 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 941 (A941S)
Ref Sequence ENSEMBL: ENSMUSP00000022450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022450]
Predicted Effect probably damaging
Transcript: ENSMUST00000022450
AA Change: A941S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022450
Gene: ENSMUSG00000040651
AA Change: A941S

DomainStartEndE-ValueType
low complexity region 20 27 N/A INTRINSIC
low complexity region 42 61 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
Pfam:DUF3715 153 314 1.5e-55 PFAM
low complexity region 442 457 N/A INTRINSIC
low complexity region 1087 1102 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for ENU mutations are not viable past gastrulation. [provided by MGI curators]
Allele List at MGI

All alleles(26) : Gene trapped(26)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik C A 4: 147,941,380 T119K probably benign Het
Abca13 T A 11: 9,277,922 L655* probably null Het
Aifm2 A G 10: 61,726,392 Y69C probably damaging Het
Atp2c1 C T 9: 105,442,831 V448I probably benign Het
Barx2 A G 9: 31,859,011 S74P probably damaging Het
Bod1l T C 5: 41,821,155 K939E probably damaging Het
Cdh12 T A 15: 21,358,864 Y125N probably damaging Het
Cdh12 C A 15: 21,358,863 F124L probably benign Het
Cdx2 A G 5: 147,306,667 Y106H possibly damaging Het
Chmp1a C T 8: 123,206,241 G158S probably damaging Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Cntnap1 A T 11: 101,188,876 Y1277F possibly damaging Het
Dennd4c A C 4: 86,825,872 D1317A probably benign Het
Dgcr2 C T 16: 17,858,378 G176D probably benign Het
Dock2 A T 11: 34,310,362 M993K possibly damaging Het
Dpy19l1 G A 9: 24,503,001 P44S probably benign Het
Dsg2 C T 18: 20,575,064 P74L probably benign Het
Epg5 T A 18: 78,022,679 F2078Y probably damaging Het
Fbn1 C A 2: 125,505,482 R41L possibly damaging Het
Gemin5 G A 11: 58,151,594 T467M probably damaging Het
Gm11744 A T 11: 116,659,373 T76S possibly damaging Het
Gm6205 T G 5: 94,683,557 L141R probably damaging Het
Hexb T C 13: 97,194,199 Q102R probably benign Het
Hmcn2 A G 2: 31,396,115 D2093G probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Igkv1-131 A G 6: 67,766,067 Y111H probably damaging Het
Il6st G T 13: 112,487,747 G177V probably benign Het
Kank4 G A 4: 98,778,678 Q511* probably null Het
Krt90 A G 15: 101,559,199 L248P probably damaging Het
Krtap5-2 A G 7: 142,174,849 C187R unknown Het
Lonp1 C A 17: 56,626,573 A101S probably benign Het
Nckap5l A G 15: 99,423,177 C1241R probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr339 A G 2: 36,422,321 T308A probably benign Het
Olfr772 T C 10: 129,174,232 D263G probably benign Het
Pcdh15 T A 10: 74,506,475 C1131* probably null Het
Pcdhgc3 A G 18: 37,807,794 D416G probably damaging Het
Pikfyve T C 1: 65,245,735 M786T possibly damaging Het
Pink1 A T 4: 138,317,962 M297K probably benign Het
Pln T C 10: 53,343,879 Y6H unknown Het
Ppp2r2c A G 5: 36,947,086 D270G probably damaging Het
Pxylp1 A G 9: 96,839,084 probably null Het
Rab11fip4 A T 11: 79,690,774 N532Y possibly damaging Het
Ralgapa1 C A 12: 55,741,523 V592L probably damaging Het
Robo2 T C 16: 73,956,610 D793G probably damaging Het
Sec14l1 G A 11: 117,143,416 probably null Het
Srcap T A 7: 127,525,369 V237E probably damaging Het
Srl A G 16: 4,497,145 I211T probably benign Het
Tet3 A G 6: 83,379,927 V883A probably damaging Het
Trim46 A G 3: 89,243,916 Y113H probably benign Het
Trim58 G A 11: 58,647,083 A267T probably benign Het
Tsks G A 7: 44,957,662 G140S Het
Vmn2r110 C A 17: 20,583,057 V419L probably benign Het
Vmn2r66 A G 7: 85,007,062 F249L probably benign Het
Vps8 A C 16: 21,495,902 D584A probably benign Het
Zfp605 T A 5: 110,128,197 C394S probably damaging Het
Zscan4e A G 7: 11,307,132 I271T probably benign Het
Other mutations in Fam208a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Fam208a APN 14 27448206 missense probably damaging 1.00
IGL00467:Fam208a APN 14 27448164 missense probably benign 0.02
IGL01071:Fam208a APN 14 27442622 critical splice donor site probably null
IGL01351:Fam208a APN 14 27464301 missense probably benign 0.02
IGL01375:Fam208a APN 14 27440163 missense probably damaging 1.00
IGL01509:Fam208a APN 14 27459774 splice site probably benign
IGL02342:Fam208a APN 14 27476667 missense possibly damaging 0.83
IGL03105:Fam208a APN 14 27442552 missense probably damaging 0.98
IGL03131:Fam208a APN 14 27461179 nonsense probably null
IGL03248:Fam208a APN 14 27476692 missense probably damaging 1.00
IGL03383:Fam208a APN 14 27441961 missense possibly damaging 0.93
balsam UTSW 14 27461150 missense probably benign 0.01
santa_rosa UTSW 14 27476701 splice site probably null
D4043:Fam208a UTSW 14 27471992 missense probably benign 0.07
R0147:Fam208a UTSW 14 27471768 missense probably benign 0.23
R0512:Fam208a UTSW 14 27446406 missense probably damaging 1.00
R0589:Fam208a UTSW 14 27461150 missense probably benign 0.01
R0609:Fam208a UTSW 14 27461750 missense probably benign 0.09
R0798:Fam208a UTSW 14 27476636 missense probably damaging 1.00
R1107:Fam208a UTSW 14 27479723 nonsense probably null
R1205:Fam208a UTSW 14 27461318 missense probably damaging 1.00
R1376:Fam208a UTSW 14 27429381 missense probably benign 0.00
R1376:Fam208a UTSW 14 27429381 missense probably benign 0.00
R1441:Fam208a UTSW 14 27464260 nonsense probably null
R1493:Fam208a UTSW 14 27449969 missense probably damaging 1.00
R1527:Fam208a UTSW 14 27480093 critical splice donor site probably null
R1729:Fam208a UTSW 14 27479633 missense probably damaging 1.00
R1752:Fam208a UTSW 14 27471928 nonsense probably null
R1960:Fam208a UTSW 14 27438664 missense probably damaging 1.00
R1960:Fam208a UTSW 14 27479789 missense possibly damaging 0.95
R1965:Fam208a UTSW 14 27442554 missense probably damaging 1.00
R2074:Fam208a UTSW 14 27461213 missense probably benign 0.03
R2107:Fam208a UTSW 14 27461787 critical splice donor site probably null
R2130:Fam208a UTSW 14 27446388 missense probably damaging 1.00
R2130:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2131:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2133:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2140:Fam208a UTSW 14 27480035 missense probably damaging 1.00
R2184:Fam208a UTSW 14 27466184 missense possibly damaging 0.83
R2279:Fam208a UTSW 14 27442495 missense probably damaging 1.00
R3979:Fam208a UTSW 14 27477130 missense possibly damaging 0.95
R4113:Fam208a UTSW 14 27459961 nonsense probably null
R4434:Fam208a UTSW 14 27449861 critical splice donor site probably null
R4562:Fam208a UTSW 14 27466308 missense possibly damaging 0.67
R4568:Fam208a UTSW 14 27476701 splice site probably null
R4754:Fam208a UTSW 14 27461095 missense probably benign
R4980:Fam208a UTSW 14 27461425 missense probably benign 0.39
R4993:Fam208a UTSW 14 27429114 missense possibly damaging 0.88
R5200:Fam208a UTSW 14 27429226 missense probably benign 0.41
R5316:Fam208a UTSW 14 27472035 missense possibly damaging 0.52
R5599:Fam208a UTSW 14 27479929 missense probably benign 0.01
R5678:Fam208a UTSW 14 27429123 small insertion probably benign
R5680:Fam208a UTSW 14 27429123 small insertion probably benign
R5887:Fam208a UTSW 14 27466297 nonsense probably null
R6181:Fam208a UTSW 14 27472278 missense probably benign 0.01
R6556:Fam208a UTSW 14 27429258 missense probably benign
R6603:Fam208a UTSW 14 27446386 missense probably damaging 1.00
R6829:Fam208a UTSW 14 27442481 missense possibly damaging 0.90
R6864:Fam208a UTSW 14 27461158 missense probably damaging 0.96
R6919:Fam208a UTSW 14 27449801 nonsense probably null
R7046:Fam208a UTSW 14 27472435 missense probably damaging 1.00
R7057:Fam208a UTSW 14 27461651 missense probably damaging 0.97
R7064:Fam208a UTSW 14 27472331 missense probably benign 0.09
R7290:Fam208a UTSW 14 27438653 missense probably damaging 1.00
R7303:Fam208a UTSW 14 27471852 missense probably damaging 1.00
R7439:Fam208a UTSW 14 27471645 missense probably damaging 1.00
R7524:Fam208a UTSW 14 27466203 missense probably damaging 0.99
R7580:Fam208a UTSW 14 27466286 missense probably benign 0.29
R7726:Fam208a UTSW 14 27447497 missense probably damaging 0.99
R7771:Fam208a UTSW 14 27467559 missense probably damaging 1.00
R7782:Fam208a UTSW 14 27471944 missense probably benign 0.07
R7795:Fam208a UTSW 14 27481383 missense
R7835:Fam208a UTSW 14 27476643 missense probably damaging 1.00
R7954:Fam208a UTSW 14 27447524 critical splice donor site probably null
R7981:Fam208a UTSW 14 27446416 missense possibly damaging 0.49
R8101:Fam208a UTSW 14 27442481 missense possibly damaging 0.90
R8160:Fam208a UTSW 14 27449956 missense probably damaging 1.00
X0002:Fam208a UTSW 14 27472106 missense possibly damaging 0.90
Z1176:Fam208a UTSW 14 27429208 missense probably damaging 0.97
Z1176:Fam208a UTSW 14 27477148 missense probably damaging 1.00
Z1177:Fam208a UTSW 14 27448250 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTAGCCTATAAGTAGAGCAGATAG -3'
(R):5'- ACTCTAGGAAGCTCTGCTGC -3'

Sequencing Primer
(F):5'- GGACATAGGGTTTACACAGTTTATTG -3'
(R):5'- TGCTGGCACACACTGCTC -3'
Posted On2020-07-28