Incidental Mutation 'R8308:Gm10188'
ID641172
Institutional Source Beutler Lab
Gene Symbol Gm10188
Ensembl Gene ENSMUSG00000066936
Gene Namepredicted gene 10188
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R8308 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location132229048-132229767 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 132229572 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 19 (V19I)
Ref Sequence ENSEMBL: ENSMUSP00000083731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086544] [ENSMUST00000112357] [ENSMUST00000185436] [ENSMUST00000187339] [ENSMUST00000188169] [ENSMUST00000191418]
Predicted Effect unknown
Transcript: ENSMUST00000086544
AA Change: V19I
SMART Domains Protein: ENSMUSP00000083731
Gene: ENSMUSG00000066936
AA Change: V19I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112357
SMART Domains Protein: ENSMUSP00000107976
Gene: ENSMUSG00000079330

DomainStartEndE-ValueType
Pfam:LEM 3 42 9.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185436
SMART Domains Protein: ENSMUSP00000140418
Gene: ENSMUSG00000079330

DomainStartEndE-ValueType
LEM 2 45 1.1e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187339
SMART Domains Protein: ENSMUSP00000139708
Gene: ENSMUSG00000079330

DomainStartEndE-ValueType
LEM 2 45 1.1e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188169
SMART Domains Protein: ENSMUSP00000140524
Gene: ENSMUSG00000079330

DomainStartEndE-ValueType
LEM 2 45 1.1e-9 SMART
low complexity region 81 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191418
SMART Domains Protein: ENSMUSP00000140193
Gene: ENSMUSG00000079330

DomainStartEndE-ValueType
LEM 2 45 1.1e-9 SMART
low complexity region 81 92 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,267,683 T1457A probably damaging Het
Acot8 A T 2: 164,804,743 S25R probably benign Het
Ap2a2 T C 7: 141,630,299 V850A probably benign Het
Baiap2l1 T A 5: 144,277,677 E402D probably benign Het
Bptf T C 11: 107,052,989 K2689E probably damaging Het
Cdh22 C A 2: 165,112,178 D808Y probably damaging Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Cipc A G 12: 86,962,035 T223A probably benign Het
Crem G T 18: 3,295,397 T57K possibly damaging Het
Cyp17a1 T A 19: 46,668,077 I393F probably benign Het
Dgcr2 C T 16: 17,858,378 G176D probably benign Het
Dock3 C A 9: 106,913,172 V1451L probably benign Het
Dsg2 C T 18: 20,575,064 P74L probably benign Het
Ece1 T C 4: 137,936,764 V224A probably damaging Het
Flg A T 3: 93,283,279 S152C unknown Het
Gcsam A T 16: 45,610,539 N3I probably damaging Het
Gm5538 A G 3: 59,752,149 D341G probably damaging Het
Gpr27 T C 6: 99,693,256 L193P probably damaging Het
Grin2b A T 6: 135,923,076 V269E probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Kif14 A G 1: 136,515,913 I1275V possibly damaging Het
Krt27 T C 11: 99,349,036 E234G probably benign Het
Lmo7 T C 14: 101,902,371 probably null Het
Matk T G 10: 81,258,287 S18A probably benign Het
Mbd3l1 A G 9: 18,484,590 T4A probably benign Het
Mettl23 G A 11: 116,848,359 probably null Het
Ncam1 A T 9: 49,568,517 W54R probably damaging Het
Olfm5 A G 7: 104,154,399 Y286H probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr194 C T 16: 59,119,536 C178Y probably damaging Het
Olfr735 T C 14: 50,345,465 I326V probably benign Het
Olfr976 T A 9: 39,956,969 M1L probably benign Het
Pmch A G 10: 88,091,752 Y105C probably damaging Het
Prg3 A G 2: 84,989,332 T57A probably benign Het
Ptpn13 A G 5: 103,540,972 E877G probably damaging Het
Ptprt A G 2: 161,927,646 V433A probably benign Het
Rufy1 A T 11: 50,406,406 D406E probably benign Het
Scara5 C T 14: 65,689,785 R44W probably damaging Het
Scg2 T G 1: 79,436,859 K49T probably benign Het
Slc40a1 A G 1: 45,911,020 I424T probably benign Het
Slc4a8 T A 15: 100,795,854 S479T probably damaging Het
Sorl1 T C 9: 42,018,160 D1139G probably damaging Het
Srcap A G 7: 127,553,181 I2206V possibly damaging Het
Tpk1 T C 6: 43,665,777 E9G probably benign Het
Ttn C T 2: 76,812,301 V13297I possibly damaging Het
Uchl3 T C 14: 101,695,219 probably null Het
Usp12 T C 5: 146,751,941 D201G probably damaging Het
Vmn1r193 C T 13: 22,218,976 R282H probably benign Het
Vmn2r104 T C 17: 20,040,778 D461G possibly damaging Het
Zfp131 A G 13: 119,782,904 M80T possibly damaging Het
Zfp457 A G 13: 67,293,599 L304P probably benign Het
Zswim3 A G 2: 164,821,646 E682G probably damaging Het
Other mutations in Gm10188
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02493:Gm10188 APN 1 132229405 nonsense probably null
IGL02894:Gm10188 APN 1 132229299 intron probably benign
R5878:Gm10188 UTSW 1 132229202 intron probably benign
Predicted Primers PCR Primer
(F):5'- GAGCTCTGCTTTGCCTCAAAC -3'
(R):5'- GGCTTGGTTCACATTCTGTCCAG -3'

Sequencing Primer
(F):5'- TGCCTCAAACTGATACATTTCAC -3'
(R):5'- ACACGGGTGGCCCTCATTAG -3'
Posted On2020-07-28