Incidental Mutation 'R8308:Tpk1'
ID641187
Institutional Source Beutler Lab
Gene Symbol Tpk1
Ensembl Gene ENSMUSG00000029735
Gene Namethiamine pyrophosphokinase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8308 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location43345001-43666278 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43665777 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 9 (E9G)
Ref Sequence ENSEMBL: ENSMUSP00000065631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067888] [ENSMUST00000114644]
PDB Structure Mouse Thiamin Pyrophosphokinase Complexed with Thiamin [X-RAY DIFFRACTION]
Mouse Thiamin Pyrophosphokinase in a Ternary Complex with Pyrithiamin Pyrophosphate and AMP at 2.5 angstrom [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000067888
AA Change: E9G

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000065631
Gene: ENSMUSG00000029735
AA Change: E9G

DomainStartEndE-ValueType
Pfam:TPK_catalytic 30 155 2.4e-44 PFAM
TPK_B1_binding 168 235 5.12e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114644
AA Change: E9G

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110291
Gene: ENSMUSG00000029735
AA Change: E9G

DomainStartEndE-ValueType
TPK_B1_binding 119 186 5.12e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein, that exists as a homodimer, which catalyzes the conversion of thiamine to thiamine pyrophosphate. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,267,683 T1457A probably damaging Het
Acot8 A T 2: 164,804,743 S25R probably benign Het
Ap2a2 T C 7: 141,630,299 V850A probably benign Het
Baiap2l1 T A 5: 144,277,677 E402D probably benign Het
Bptf T C 11: 107,052,989 K2689E probably damaging Het
Cdh22 C A 2: 165,112,178 D808Y probably damaging Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Cipc A G 12: 86,962,035 T223A probably benign Het
Crem G T 18: 3,295,397 T57K possibly damaging Het
Cyp17a1 T A 19: 46,668,077 I393F probably benign Het
Dgcr2 C T 16: 17,858,378 G176D probably benign Het
Dock3 C A 9: 106,913,172 V1451L probably benign Het
Dsg2 C T 18: 20,575,064 P74L probably benign Het
Ece1 T C 4: 137,936,764 V224A probably damaging Het
Flg A T 3: 93,283,279 S152C unknown Het
Gcsam A T 16: 45,610,539 N3I probably damaging Het
Gm10188 C T 1: 132,229,572 V19I unknown Het
Gm5538 A G 3: 59,752,149 D341G probably damaging Het
Gpr27 T C 6: 99,693,256 L193P probably damaging Het
Grin2b A T 6: 135,923,076 V269E probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Kif14 A G 1: 136,515,913 I1275V possibly damaging Het
Krt27 T C 11: 99,349,036 E234G probably benign Het
Lmo7 T C 14: 101,902,371 probably null Het
Matk T G 10: 81,258,287 S18A probably benign Het
Mbd3l1 A G 9: 18,484,590 T4A probably benign Het
Mettl23 G A 11: 116,848,359 probably null Het
Ncam1 A T 9: 49,568,517 W54R probably damaging Het
Olfm5 A G 7: 104,154,399 Y286H probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr194 C T 16: 59,119,536 C178Y probably damaging Het
Olfr735 T C 14: 50,345,465 I326V probably benign Het
Olfr976 T A 9: 39,956,969 M1L probably benign Het
Pmch A G 10: 88,091,752 Y105C probably damaging Het
Prg3 A G 2: 84,989,332 T57A probably benign Het
Ptpn13 A G 5: 103,540,972 E877G probably damaging Het
Ptprt A G 2: 161,927,646 V433A probably benign Het
Rufy1 A T 11: 50,406,406 D406E probably benign Het
Scara5 C T 14: 65,689,785 R44W probably damaging Het
Scg2 T G 1: 79,436,859 K49T probably benign Het
Slc40a1 A G 1: 45,911,020 I424T probably benign Het
Slc4a8 T A 15: 100,795,854 S479T probably damaging Het
Sorl1 T C 9: 42,018,160 D1139G probably damaging Het
Srcap A G 7: 127,553,181 I2206V possibly damaging Het
Ttn C T 2: 76,812,301 V13297I possibly damaging Het
Uchl3 T C 14: 101,695,219 probably null Het
Usp12 T C 5: 146,751,941 D201G probably damaging Het
Vmn1r193 C T 13: 22,218,976 R282H probably benign Het
Vmn2r104 T C 17: 20,040,778 D461G possibly damaging Het
Zfp131 A G 13: 119,782,904 M80T possibly damaging Het
Zfp457 A G 13: 67,293,599 L304P probably benign Het
Zswim3 A G 2: 164,821,646 E682G probably damaging Het
Other mutations in Tpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0084:Tpk1 UTSW 6 43346829 missense possibly damaging 0.94
R1736:Tpk1 UTSW 6 43611350 missense probably benign 0.09
R2348:Tpk1 UTSW 6 43346844 missense probably damaging 0.97
R4664:Tpk1 UTSW 6 43611335 missense probably benign 0.08
R4804:Tpk1 UTSW 6 43593078 intron probably benign
R5172:Tpk1 UTSW 6 43560017 splice site probably null
R5230:Tpk1 UTSW 6 43423719 missense probably damaging 1.00
R5485:Tpk1 UTSW 6 43665812 utr 5 prime probably benign
R6126:Tpk1 UTSW 6 43423660 missense probably damaging 1.00
R6140:Tpk1 UTSW 6 43423701 missense probably benign 0.00
R6326:Tpk1 UTSW 6 43346802 missense possibly damaging 0.77
R6460:Tpk1 UTSW 6 43469027 missense probably benign 0.01
R6767:Tpk1 UTSW 6 43346793 missense possibly damaging 0.93
R8061:Tpk1 UTSW 6 43346844 missense probably damaging 0.97
R8120:Tpk1 UTSW 6 43468996 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTGTCAAATGTTCCACGGTTGG -3'
(R):5'- AGATTCCAGGTTCTCCAGCC -3'

Sequencing Primer
(F):5'- GTCCTCACAAAAGTTCTACAGGG -3'
(R):5'- AGCCTCTGCCTGGGACTTTC -3'
Posted On2020-07-28