Mutagenetix > Incidental Mutation

Incidental Mutation 'R8308:Grin2b'

641189

Institutional Source

Beutler Lab

Gene Symbol

Grin2b

Ensembl Gene

ENSMUSG00000030209

Gene Name

glutamate receptor, ionotropic, NMDA2B (epsilon 2)

Synonyms

GluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B

MMRRC Submission

067793-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8308 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

135713233-136173511 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 135923076 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 269 (V269E)

Ref Sequence

ENSEMBL: ENSMUSP00000142696 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905] [ENSMUST00000152012]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000053880
AA Change: V269E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: V269E

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	106	306	8.6e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	4.8e-270	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111905
AA Change: V269E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: V269E

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	56	307	4.2e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	2.1e-245	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000152012
AA Change: V269E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000142696
Gene: ENSMUSG00000030209
AA Change: V269E

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	66	312	1.6e-9	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	T	C	17: 24,267,683	T1457A	probably damaging	Het
Acot8	A	T	2: 164,804,743	S25R	probably benign	Het
Ap2a2	T	C	7: 141,630,299	V850A	probably benign	Het
Baiap2l1	T	A	5: 144,277,677	E402D	probably benign	Het
Bptf	T	C	11: 107,052,989	K2689E	probably damaging	Het
Cdh22	C	A	2: 165,112,178	D808Y	probably damaging	Het
Cilp	G	A	9: 65,279,004	G794S	probably damaging	Het
Cipc	A	G	12: 86,962,035	T223A	probably benign	Het
Crem	G	T	18: 3,295,397	T57K	possibly damaging	Het
Cyp17a1	T	A	19: 46,668,077	I393F	probably benign	Het
Dgcr2	C	T	16: 17,858,378	G176D	probably benign	Het
Dock3	C	A	9: 106,913,172	V1451L	probably benign	Het
Dsg2	C	T	18: 20,575,064	P74L	probably benign	Het
Ece1	T	C	4: 137,936,764	V224A	probably damaging	Het
Flg	A	T	3: 93,283,279	S152C	unknown	Het
Gcsam	A	T	16: 45,610,539	N3I	probably damaging	Het
Gm10188	C	T	1: 132,229,572	V19I	unknown	Het
Gm5538	A	G	3: 59,752,149	D341G	probably damaging	Het
Gpr27	T	C	6: 99,693,256	L193P	probably damaging	Het
Hmmr	G	A	11: 40,721,672	S206F	probably damaging	Het
Kif14	A	G	1: 136,515,913	I1275V	possibly damaging	Het
Krt27	T	C	11: 99,349,036	E234G	probably benign	Het
Lmo7	T	C	14: 101,902,371		probably null	Het
Matk	T	G	10: 81,258,287	S18A	probably benign	Het
Mbd3l1	A	G	9: 18,484,590	T4A	probably benign	Het
Mettl23	G	A	11: 116,848,359		probably null	Het
Ncam1	A	T	9: 49,568,517	W54R	probably damaging	Het
Olfm5	A	G	7: 104,154,399	Y286H	probably damaging	Het
Olfr1205	G	A	2: 88,831,289	M57I	possibly damaging	Het
Olfr194	C	T	16: 59,119,536	C178Y	probably damaging	Het
Olfr735	T	C	14: 50,345,465	I326V	probably benign	Het
Olfr976	T	A	9: 39,956,969	M1L	probably benign	Het
Pmch	A	G	10: 88,091,752	Y105C	probably damaging	Het
Prg3	A	G	2: 84,989,332	T57A	probably benign	Het
Ptpn13	A	G	5: 103,540,972	E877G	probably damaging	Het
Ptprt	A	G	2: 161,927,646	V433A	probably benign	Het
Rufy1	A	T	11: 50,406,406	D406E	probably benign	Het
Scara5	C	T	14: 65,689,785	R44W	probably damaging	Het
Scg2	T	G	1: 79,436,859	K49T	probably benign	Het
Slc40a1	A	G	1: 45,911,020	I424T	probably benign	Het
Slc4a8	T	A	15: 100,795,854	S479T	probably damaging	Het
Sorl1	T	C	9: 42,018,160	D1139G	probably damaging	Het
Srcap	A	G	7: 127,553,181	I2206V	possibly damaging	Het
Tpk1	T	C	6: 43,665,777	E9G	probably benign	Het
Ttn	C	T	2: 76,812,301	V13297I	possibly damaging	Het
Uchl3	T	C	14: 101,695,219		probably null	Het
Usp12	T	C	5: 146,751,941	D201G	probably damaging	Het
Vmn1r193	C	T	13: 22,218,976	R282H	probably benign	Het
Vmn2r104	T	C	17: 20,040,778	D461G	possibly damaging	Het
Zfp131	A	G	13: 119,782,904	M80T	possibly damaging	Het
Zfp457	A	G	13: 67,293,599	L304P	probably benign	Het
Zswim3	A	G	2: 164,821,646	E682G	probably damaging	Het

Other mutations in Grin2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Grin2b	APN	6	135,736,331 (GRCm38)	missense	possibly damaging	0.55
IGL00835:Grin2b	APN	6	135,733,570 (GRCm38)	missense	probably damaging	1.00
IGL01401:Grin2b	APN	6	135,736,363 (GRCm38)	missense	probably damaging	1.00
IGL01523:Grin2b	APN	6	136,044,265 (GRCm38)	missense	probably null	0.99
IGL01719:Grin2b	APN	6	135,733,381 (GRCm38)	missense	probably damaging	0.97
IGL01907:Grin2b	APN	6	135,733,740 (GRCm38)	missense	probably damaging	1.00
IGL01996:Grin2b	APN	6	135,732,586 (GRCm38)	missense	probably damaging	1.00
IGL02309:Grin2b	APN	6	135,736,472 (GRCm38)	missense	probably damaging	1.00
IGL02312:Grin2b	APN	6	135,739,090 (GRCm38)	missense	probably damaging	1.00
IGL02409:Grin2b	APN	6	136,043,908 (GRCm38)	missense	possibly damaging	0.89
IGL02527:Grin2b	APN	6	135,923,391 (GRCm38)	missense	probably damaging	1.00
IGL02535:Grin2b	APN	6	135,779,369 (GRCm38)	missense	possibly damaging	0.70
IGL02570:Grin2b	APN	6	135,922,998 (GRCm38)	missense	probably damaging	1.00
IGL02702:Grin2b	APN	6	135,739,132 (GRCm38)	missense	probably damaging	0.99
IGL03001:Grin2b	APN	6	135,739,115 (GRCm38)	missense	probably damaging	1.00
IGL03274:Grin2b	APN	6	135,780,255 (GRCm38)	missense	possibly damaging	0.90
R0055:Grin2b	UTSW	6	135,923,203 (GRCm38)	missense	probably benign
R0055:Grin2b	UTSW	6	135,923,203 (GRCm38)	missense	probably benign
R0164:Grin2b	UTSW	6	135,778,648 (GRCm38)	splice site	probably benign
R0194:Grin2b	UTSW	6	135,779,305 (GRCm38)	missense	probably damaging	1.00
R0594:Grin2b	UTSW	6	135,733,929 (GRCm38)	missense	probably damaging	1.00
R1434:Grin2b	UTSW	6	135,843,195 (GRCm38)	missense	probably benign	0.04
R1928:Grin2b	UTSW	6	136,044,046 (GRCm38)	missense	probably damaging	1.00
R1942:Grin2b	UTSW	6	135,732,732 (GRCm38)	missense	possibly damaging	0.93
R1996:Grin2b	UTSW	6	136,044,211 (GRCm38)	missense	possibly damaging	0.52
R2002:Grin2b	UTSW	6	135,733,245 (GRCm38)	missense	probably damaging	1.00
R2020:Grin2b	UTSW	6	135,733,896 (GRCm38)	missense	probably benign	0.12
R2103:Grin2b	UTSW	6	135,780,140 (GRCm38)	missense	probably benign	0.02
R2127:Grin2b	UTSW	6	135,778,700 (GRCm38)	missense	probably benign	0.03
R2495:Grin2b	UTSW	6	135,733,182 (GRCm38)	missense	probably damaging	1.00
R2656:Grin2b	UTSW	6	135,733,429 (GRCm38)	missense	probably damaging	1.00
R2847:Grin2b	UTSW	6	135,740,953 (GRCm38)	missense	probably damaging	1.00
R2866:Grin2b	UTSW	6	135,733,639 (GRCm38)	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135,733,639 (GRCm38)	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135,733,639 (GRCm38)	missense	probably damaging	1.00
R3196:Grin2b	UTSW	6	135,732,455 (GRCm38)	small deletion	probably benign
R3418:Grin2b	UTSW	6	135,843,110 (GRCm38)	missense	probably benign	0.02
R3808:Grin2b	UTSW	6	135,923,271 (GRCm38)	missense	probably damaging	0.99
R4028:Grin2b	UTSW	6	135,736,435 (GRCm38)	missense	probably damaging	1.00
R4602:Grin2b	UTSW	6	135,778,741 (GRCm38)	missense	probably damaging	1.00
R4624:Grin2b	UTSW	6	135,733,825 (GRCm38)	missense	probably damaging	0.99
R4677:Grin2b	UTSW	6	135,774,872 (GRCm38)	missense	probably benign	0.13
R4744:Grin2b	UTSW	6	135,778,699 (GRCm38)	missense	probably damaging	1.00
R5020:Grin2b	UTSW	6	135,733,407 (GRCm38)	missense	probably benign	0.01
R5051:Grin2b	UTSW	6	135,779,395 (GRCm38)	missense	possibly damaging	0.84
R5105:Grin2b	UTSW	6	135,732,441 (GRCm38)	missense	probably benign	0.03
R5125:Grin2b	UTSW	6	135,923,299 (GRCm38)	missense	possibly damaging	0.89
R5146:Grin2b	UTSW	6	135,779,342 (GRCm38)	missense	probably damaging	1.00
R5318:Grin2b	UTSW	6	135,733,918 (GRCm38)	missense	probably damaging	0.99
R5349:Grin2b	UTSW	6	136,044,283 (GRCm38)	missense	possibly damaging	0.93
R5426:Grin2b	UTSW	6	135,732,368 (GRCm38)	missense	probably damaging	1.00
R5438:Grin2b	UTSW	6	135,736,306 (GRCm38)	missense	probably damaging	1.00
R5439:Grin2b	UTSW	6	135,736,306 (GRCm38)	missense	probably damaging	1.00
R5440:Grin2b	UTSW	6	135,736,306 (GRCm38)	missense	probably damaging	1.00
R5530:Grin2b	UTSW	6	135,733,723 (GRCm38)	missense	probably benign	0.00
R5603:Grin2b	UTSW	6	135,923,397 (GRCm38)	missense	probably damaging	1.00
R5657:Grin2b	UTSW	6	135,733,087 (GRCm38)	missense	possibly damaging	0.48
R5788:Grin2b	UTSW	6	135,740,964 (GRCm38)	missense	probably benign	0.24
R5941:Grin2b	UTSW	6	135,736,373 (GRCm38)	missense	probably damaging	0.99
R6057:Grin2b	UTSW	6	135,733,944 (GRCm38)	missense	possibly damaging	0.84
R6137:Grin2b	UTSW	6	135,923,458 (GRCm38)	missense	possibly damaging	0.89
R6216:Grin2b	UTSW	6	135,772,399 (GRCm38)	missense	probably damaging	1.00
R6309:Grin2b	UTSW	6	135,733,027 (GRCm38)	missense	probably benign	0.00
R6316:Grin2b	UTSW	6	135,780,279 (GRCm38)	missense	probably benign	0.00
R6419:Grin2b	UTSW	6	135,740,967 (GRCm38)	missense	probably damaging	1.00
R6551:Grin2b	UTSW	6	135,733,344 (GRCm38)	missense	probably damaging	1.00
R6612:Grin2b	UTSW	6	135,740,998 (GRCm38)	missense	probably damaging	1.00
R6616:Grin2b	UTSW	6	135,732,551 (GRCm38)	missense	probably benign
R6647:Grin2b	UTSW	6	135,733,110 (GRCm38)	missense	probably damaging	1.00
R6806:Grin2b	UTSW	6	135,774,828 (GRCm38)	missense	possibly damaging	0.84
R6976:Grin2b	UTSW	6	135,780,200 (GRCm38)	missense	probably benign
R7033:Grin2b	UTSW	6	135,923,038 (GRCm38)	missense	probably damaging	1.00
R7058:Grin2b	UTSW	6	135,780,306 (GRCm38)	missense	probably damaging	0.97
R7144:Grin2b	UTSW	6	135,733,476 (GRCm38)	missense	possibly damaging	0.50
R7190:Grin2b	UTSW	6	135,732,948 (GRCm38)	missense	possibly damaging	0.46
R7238:Grin2b	UTSW	6	135,780,251 (GRCm38)	missense	probably damaging	0.97
R7453:Grin2b	UTSW	6	135,740,949 (GRCm38)	missense	possibly damaging	0.56
R7553:Grin2b	UTSW	6	135,772,396 (GRCm38)	missense	possibly damaging	0.88
R7585:Grin2b	UTSW	6	135,779,303 (GRCm38)	missense	probably damaging	0.99
R7615:Grin2b	UTSW	6	135,923,364 (GRCm38)	missense	probably damaging	1.00
R7632:Grin2b	UTSW	6	135,732,555 (GRCm38)	missense	probably benign	0.02
R7779:Grin2b	UTSW	6	135,778,794 (GRCm38)	nonsense	probably null
R8058:Grin2b	UTSW	6	135,733,227 (GRCm38)	missense	probably damaging	1.00
R8084:Grin2b	UTSW	6	135,733,488 (GRCm38)	missense	probably benign	0.03
R8145:Grin2b	UTSW	6	135,732,499 (GRCm38)	missense	probably benign	0.01
R8357:Grin2b	UTSW	6	135,732,199 (GRCm38)	missense	probably benign	0.00
R8379:Grin2b	UTSW	6	135,922,969 (GRCm38)	missense	probably damaging	1.00
R8429:Grin2b	UTSW	6	135,733,916 (GRCm38)	missense	probably damaging	1.00
R8457:Grin2b	UTSW	6	135,732,199 (GRCm38)	missense	probably benign	0.00
R8746:Grin2b	UTSW	6	135,922,987 (GRCm38)	missense	probably benign	0.02
R8925:Grin2b	UTSW	6	135,772,341 (GRCm38)	missense	probably damaging	0.97
R8927:Grin2b	UTSW	6	135,772,341 (GRCm38)	missense	probably damaging	0.97
R8963:Grin2b	UTSW	6	136,044,009 (GRCm38)	missense	probably damaging	1.00
R9075:Grin2b	UTSW	6	135,732,511 (GRCm38)	frame shift	probably null
R9076:Grin2b	UTSW	6	135,732,511 (GRCm38)	frame shift	probably null
R9172:Grin2b	UTSW	6	135,779,257 (GRCm38)	missense	possibly damaging	0.84
R9520:Grin2b	UTSW	6	135,733,401 (GRCm38)	missense	probably damaging	1.00
R9740:Grin2b	UTSW	6	135,922,870 (GRCm38)	critical splice donor site	probably null
RF001:Grin2b	UTSW	6	136,044,240 (GRCm38)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGCAGGACAGTTCCACACTC -3'
(R):5'- TGGCGACTCTAAGATCCAGAATC -3'

Sequencing Primer
(F):5'- CAGCATGTTAGACTGGTAGATCCTC -3'
(R):5'- GACTCTAAGATCCAGAATCAGCTG -3'

Posted On

2020-07-28