Incidental Mutation 'R8308:Mbd3l1'
ID641193
Institutional Source Beutler Lab
Gene Symbol Mbd3l1
Ensembl Gene ENSMUSG00000038691
Gene Namemethyl-CpG binding domain protein 3-like 1
SynonymsMbd3l, 1700070G05Rik, 1700095H13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8308 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location18478359-18485298 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18484590 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 4 (T4A)
Ref Sequence ENSEMBL: ENSMUSP00000063957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069218]
Predicted Effect probably benign
Transcript: ENSMUST00000069218
AA Change: T4A

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000063957
Gene: ENSMUSG00000038691
AA Change: T4A

DomainStartEndE-ValueType
Pfam:MBDa 3 74 8.5e-31 PFAM
Pfam:MBD_C 78 166 1.2e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to methyl-CpG-binding proteins but lacks the methyl-CpG binding domain. The protein is localized to discrete areas in the nucleus, and expression appears to be restricted to round spermatids, suggesting that the protein plays a role in the postmeiotic stages of male germ cell development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,267,683 T1457A probably damaging Het
Acot8 A T 2: 164,804,743 S25R probably benign Het
Ap2a2 T C 7: 141,630,299 V850A probably benign Het
Baiap2l1 T A 5: 144,277,677 E402D probably benign Het
Bptf T C 11: 107,052,989 K2689E probably damaging Het
Cdh22 C A 2: 165,112,178 D808Y probably damaging Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Cipc A G 12: 86,962,035 T223A probably benign Het
Crem G T 18: 3,295,397 T57K possibly damaging Het
Cyp17a1 T A 19: 46,668,077 I393F probably benign Het
Dgcr2 C T 16: 17,858,378 G176D probably benign Het
Dock3 C A 9: 106,913,172 V1451L probably benign Het
Dsg2 C T 18: 20,575,064 P74L probably benign Het
Ece1 T C 4: 137,936,764 V224A probably damaging Het
Flg A T 3: 93,283,279 S152C unknown Het
Gcsam A T 16: 45,610,539 N3I probably damaging Het
Gm10188 C T 1: 132,229,572 V19I unknown Het
Gm5538 A G 3: 59,752,149 D341G probably damaging Het
Gpr27 T C 6: 99,693,256 L193P probably damaging Het
Grin2b A T 6: 135,923,076 V269E probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Kif14 A G 1: 136,515,913 I1275V possibly damaging Het
Krt27 T C 11: 99,349,036 E234G probably benign Het
Lmo7 T C 14: 101,902,371 probably null Het
Matk T G 10: 81,258,287 S18A probably benign Het
Mettl23 G A 11: 116,848,359 probably null Het
Ncam1 A T 9: 49,568,517 W54R probably damaging Het
Olfm5 A G 7: 104,154,399 Y286H probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr194 C T 16: 59,119,536 C178Y probably damaging Het
Olfr735 T C 14: 50,345,465 I326V probably benign Het
Olfr976 T A 9: 39,956,969 M1L probably benign Het
Pmch A G 10: 88,091,752 Y105C probably damaging Het
Prg3 A G 2: 84,989,332 T57A probably benign Het
Ptpn13 A G 5: 103,540,972 E877G probably damaging Het
Ptprt A G 2: 161,927,646 V433A probably benign Het
Rufy1 A T 11: 50,406,406 D406E probably benign Het
Scara5 C T 14: 65,689,785 R44W probably damaging Het
Scg2 T G 1: 79,436,859 K49T probably benign Het
Slc40a1 A G 1: 45,911,020 I424T probably benign Het
Slc4a8 T A 15: 100,795,854 S479T probably damaging Het
Sorl1 T C 9: 42,018,160 D1139G probably damaging Het
Srcap A G 7: 127,553,181 I2206V possibly damaging Het
Tpk1 T C 6: 43,665,777 E9G probably benign Het
Ttn C T 2: 76,812,301 V13297I possibly damaging Het
Uchl3 T C 14: 101,695,219 probably null Het
Usp12 T C 5: 146,751,941 D201G probably damaging Het
Vmn1r193 C T 13: 22,218,976 R282H probably benign Het
Vmn2r104 T C 17: 20,040,778 D461G possibly damaging Het
Zfp131 A G 13: 119,782,904 M80T possibly damaging Het
Zfp457 A G 13: 67,293,599 L304P probably benign Het
Zswim3 A G 2: 164,821,646 E682G probably damaging Het
Other mutations in Mbd3l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02130:Mbd3l1 APN 9 18484727 missense probably damaging 1.00
R0011:Mbd3l1 UTSW 9 18484567 start gained probably benign
R0015:Mbd3l1 UTSW 9 18484858 missense probably benign 0.02
R1571:Mbd3l1 UTSW 9 18484651 missense probably damaging 1.00
R1737:Mbd3l1 UTSW 9 18484929 missense possibly damaging 0.46
R1762:Mbd3l1 UTSW 9 18485139 makesense probably null
R4981:Mbd3l1 UTSW 9 18484905 missense probably benign 0.00
R5171:Mbd3l1 UTSW 9 18485134 missense probably benign
R5244:Mbd3l1 UTSW 9 18484637 nonsense probably null
R6582:Mbd3l1 UTSW 9 18484728 missense probably benign 0.25
R7109:Mbd3l1 UTSW 9 18484914 missense possibly damaging 0.55
R7319:Mbd3l1 UTSW 9 18485121 missense probably benign 0.00
R8317:Mbd3l1 UTSW 9 18484821 missense probably benign 0.01
RF014:Mbd3l1 UTSW 9 18485000 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CAAGTTGTGGGAGAGCTTTGAC -3'
(R):5'- TTGTTCTGGCTTCTCCAAGG -3'

Sequencing Primer
(F):5'- CCTTGATGTTTCTGAATACAGGTC -3'
(R):5'- AAGGTCTCCTCCCACTGATAG -3'
Posted On2020-07-28