Incidental Mutation 'R8308:Rufy1'
ID641202
Institutional Source Beutler Lab
Gene Symbol Rufy1
Ensembl Gene ENSMUSG00000020375
Gene NameRUN and FYVE domain containing 1
SynonymsZFYVE12, 3000002E04Rik, Rabip4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.501) question?
Stock #R8308 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location50389286-50431125 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50406406 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 406 (D406E)
Ref Sequence ENSEMBL: ENSMUSP00000020643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020643]
Predicted Effect probably benign
Transcript: ENSMUST00000020643
AA Change: D406E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000020643
Gene: ENSMUSG00000020375
AA Change: D406E

DomainStartEndE-ValueType
low complexity region 15 32 N/A INTRINSIC
low complexity region 83 111 N/A INTRINSIC
RUN 211 273 1.21e-21 SMART
coiled coil region 324 384 N/A INTRINSIC
coiled coil region 409 621 N/A INTRINSIC
FYVE 638 705 1.24e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129304
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135508
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a RUN domain and a FYVE-type zinc finger domain. The encoded protein binds to phosphatidylinositol-3-phosphate (PI3P) and plays a role in early endosomal trafficking, tethering and fusion through interactions with small GTPases including Rab4, Rab5 and Rab14. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,267,683 T1457A probably damaging Het
Acot8 A T 2: 164,804,743 S25R probably benign Het
Ap2a2 T C 7: 141,630,299 V850A probably benign Het
Baiap2l1 T A 5: 144,277,677 E402D probably benign Het
Bptf T C 11: 107,052,989 K2689E probably damaging Het
Cdh22 C A 2: 165,112,178 D808Y probably damaging Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Cipc A G 12: 86,962,035 T223A probably benign Het
Crem G T 18: 3,295,397 T57K possibly damaging Het
Cyp17a1 T A 19: 46,668,077 I393F probably benign Het
Dgcr2 C T 16: 17,858,378 G176D probably benign Het
Dock3 C A 9: 106,913,172 V1451L probably benign Het
Dsg2 C T 18: 20,575,064 P74L probably benign Het
Ece1 T C 4: 137,936,764 V224A probably damaging Het
Flg A T 3: 93,283,279 S152C unknown Het
Gcsam A T 16: 45,610,539 N3I probably damaging Het
Gm10188 C T 1: 132,229,572 V19I unknown Het
Gm5538 A G 3: 59,752,149 D341G probably damaging Het
Gpr27 T C 6: 99,693,256 L193P probably damaging Het
Grin2b A T 6: 135,923,076 V269E probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Kif14 A G 1: 136,515,913 I1275V possibly damaging Het
Krt27 T C 11: 99,349,036 E234G probably benign Het
Lmo7 T C 14: 101,902,371 probably null Het
Matk T G 10: 81,258,287 S18A probably benign Het
Mbd3l1 A G 9: 18,484,590 T4A probably benign Het
Mettl23 G A 11: 116,848,359 probably null Het
Ncam1 A T 9: 49,568,517 W54R probably damaging Het
Olfm5 A G 7: 104,154,399 Y286H probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr194 C T 16: 59,119,536 C178Y probably damaging Het
Olfr735 T C 14: 50,345,465 I326V probably benign Het
Olfr976 T A 9: 39,956,969 M1L probably benign Het
Pmch A G 10: 88,091,752 Y105C probably damaging Het
Prg3 A G 2: 84,989,332 T57A probably benign Het
Ptpn13 A G 5: 103,540,972 E877G probably damaging Het
Ptprt A G 2: 161,927,646 V433A probably benign Het
Scara5 C T 14: 65,689,785 R44W probably damaging Het
Scg2 T G 1: 79,436,859 K49T probably benign Het
Slc40a1 A G 1: 45,911,020 I424T probably benign Het
Slc4a8 T A 15: 100,795,854 S479T probably damaging Het
Sorl1 T C 9: 42,018,160 D1139G probably damaging Het
Srcap A G 7: 127,553,181 I2206V possibly damaging Het
Tpk1 T C 6: 43,665,777 E9G probably benign Het
Ttn C T 2: 76,812,301 V13297I possibly damaging Het
Uchl3 T C 14: 101,695,219 probably null Het
Usp12 T C 5: 146,751,941 D201G probably damaging Het
Vmn1r193 C T 13: 22,218,976 R282H probably benign Het
Vmn2r104 T C 17: 20,040,778 D461G possibly damaging Het
Zfp131 A G 13: 119,782,904 M80T possibly damaging Het
Zfp457 A G 13: 67,293,599 L304P probably benign Het
Zswim3 A G 2: 164,821,646 E682G probably damaging Het
Other mutations in Rufy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Rufy1 APN 11 50392023 missense probably damaging 1.00
IGL01640:Rufy1 APN 11 50390378 unclassified probably benign
IGL01829:Rufy1 APN 11 50416244 nonsense probably null
IGL02559:Rufy1 APN 11 50420483 missense probably damaging 1.00
IGL03409:Rufy1 APN 11 50406483 missense probably benign 0.00
R0053:Rufy1 UTSW 11 50401465 missense probably benign 0.10
R0053:Rufy1 UTSW 11 50401465 missense probably benign 0.10
R0193:Rufy1 UTSW 11 50389852 missense probably benign 0.12
R1028:Rufy1 UTSW 11 50414598 splice site probably null
R1591:Rufy1 UTSW 11 50394928 missense probably damaging 1.00
R1818:Rufy1 UTSW 11 50414572 missense probably benign 0.43
R1952:Rufy1 UTSW 11 50406406 missense probably benign 0.01
R2228:Rufy1 UTSW 11 50397784 splice site probably null
R2982:Rufy1 UTSW 11 50419708 missense possibly damaging 0.77
R4837:Rufy1 UTSW 11 50401493 missense probably damaging 0.96
R4874:Rufy1 UTSW 11 50406450 missense possibly damaging 0.80
R4959:Rufy1 UTSW 11 50401488 missense probably benign
R4968:Rufy1 UTSW 11 50410607 missense probably benign 0.01
R5204:Rufy1 UTSW 11 50406434 missense probably damaging 1.00
R5426:Rufy1 UTSW 11 50421734 missense probably damaging 1.00
R5966:Rufy1 UTSW 11 50401488 missense probably benign
R6129:Rufy1 UTSW 11 50417248 missense probably damaging 0.99
R6930:Rufy1 UTSW 11 50398380 missense probably benign 0.05
R7073:Rufy1 UTSW 11 50404463 missense probably benign 0.05
R7462:Rufy1 UTSW 11 50407828 missense possibly damaging 0.93
R7646:Rufy1 UTSW 11 50410609 missense probably damaging 1.00
R7951:Rufy1 UTSW 11 50430909 missense probably benign
R7971:Rufy1 UTSW 11 50421671 missense probably damaging 1.00
R8773:Rufy1 UTSW 11 50430969 missense possibly damaging 0.74
R8934:Rufy1 UTSW 11 50407878 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCTCTAGGGAAGACTCAG -3'
(R):5'- CCCTAAGATCCAGCATGTTTAAAG -3'

Sequencing Primer
(F):5'- CCTCTAGGGAAGACTCAGACAATG -3'
(R):5'- AAGATCCAGCATGTTTAAAGAGTAG -3'
Posted On2020-07-28